Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0619650349:

Variant ID: vg0619650349 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19650349
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGTTATAAATAACGGGTATTACCAACTATCCATCCACACAGGATTCGTCCACACAGGACCACATAGCTATATTCATTAACCTGCACACAGTTCATTCC[A/C,T]
AGTTTTCACAAACTACCCCTCATGAGATATCACCGAGCATGTCCATGACCGCGGACGCGGCTATTCGAATAGATTAATTAACACTCTGCAGAGGTTGTAC

Reverse complement sequence

GTACAACCTCTGCAGAGTGTTAATTAATCTATTCGAATAGCCGCGTCCGCGGTCATGGACATGCTCGGTGATATCTCATGAGGGGTAGTTTGTGAAAACT[T/G,A]
GGAATGAACTGTGTGCAGGTTAATGAATATAGCTATGTGGTCCTGTGTGGACGAATCCTGTGTGGATGGATAGTTGGTAATACCCGTTATTTATAACTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	27.40%	9.88%	0.87%	T: 0.04%
All Indica	2759	93.00%	1.80%	5.00%	0.14%	T: 0.04%
All Japonica	1512	18.80%	79.80%	1.26%	0.20%	NA
Aus	269	5.90%	0.70%	88.85%	4.09%	T: 0.37%
Indica I	595	97.00%	0.30%	2.69%	0.00%	NA
Indica II	465	94.60%	3.40%	1.94%	0.00%	NA
Indica III	913	96.70%	0.70%	2.52%	0.11%	NA
Indica Intermediate	786	84.60%	3.40%	11.45%	0.38%	T: 0.13%
Temperate Japonica	767	26.60%	73.40%	0.00%	0.00%	NA
Tropical Japonica	504	8.10%	88.10%	3.57%	0.20%	NA
Japonica Intermediate	241	16.20%	82.60%	0.41%	0.83%	NA
VI/Aromatic	96	10.40%	2.10%	66.67%	20.83%	NA
Intermediate	90	50.00%	38.90%	7.78%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619650349	A -> C	LOC_Os06g33780.1	upstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> C	LOC_Os06g33790.1	upstream_gene_variant ; 3922.0bp to feature; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> C	LOC_Os06g33770.1	downstream_gene_variant ; 2261.0bp to feature; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> C	LOC_Os06g33770-LOC_Os06g33780	intergenic_region ; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> T	LOC_Os06g33780.1	upstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> T	LOC_Os06g33790.1	upstream_gene_variant ; 3922.0bp to feature; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> T	LOC_Os06g33770.1	downstream_gene_variant ; 2261.0bp to feature; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> T	LOC_Os06g33770-LOC_Os06g33780	intergenic_region ; MODIFIER	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0619650349	A -> DEL	N	N	silent_mutation	Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619650349	1.63E-07	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	4.50E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	1.91E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	1.05E-07	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	9.63E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	1.03E-09	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	2.47E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	7.87E-07	1.78E-31	mr1238	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	4.62E-30	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	6.69E-08	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	6.41E-19	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	6.16E-19	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	4.97E-08	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.71E-22	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.89E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	3.27E-06	3.33E-18	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.87E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	2.58E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.27E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	7.75E-09	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.95E-20	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	7.53E-07	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	8.99E-30	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	9.15E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.27E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	3.86E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.09E-26	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	8.78E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.65E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	8.94E-17	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	9.57E-09	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	1.36E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	8.31E-06	4.46E-24	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	3.03E-20	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349	NA	2.81E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251