\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619650349:

Variant ID: vg0619650349 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19650349
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGTTATAAATAACGGGTATTACCAACTATCCATCCACACAGGATTCGTCCACACAGGACCACATAGCTATATTCATTAACCTGCACACAGTTCATTCC[A/C,T]
AGTTTTCACAAACTACCCCTCATGAGATATCACCGAGCATGTCCATGACCGCGGACGCGGCTATTCGAATAGATTAATTAACACTCTGCAGAGGTTGTAC

Reverse complement sequence

GTACAACCTCTGCAGAGTGTTAATTAATCTATTCGAATAGCCGCGTCCGCGGTCATGGACATGCTCGGTGATATCTCATGAGGGGTAGTTTGTGAAAACT[T/G,A]
GGAATGAACTGTGTGCAGGTTAATGAATATAGCTATGTGGTCCTGTGTGGACGAATCCTGTGTGGATGGATAGTTGGTAATACCCGTTATTTATAACTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 27.40% 9.88% 0.87% T: 0.04%
All Indica  2759 93.00% 1.80% 5.00% 0.14% T: 0.04%
All Japonica  1512 18.80% 79.80% 1.26% 0.20% NA
Aus  269 5.90% 0.70% 88.85% 4.09% T: 0.37%
Indica I  595 97.00% 0.30% 2.69% 0.00% NA
Indica II  465 94.60% 3.40% 1.94% 0.00% NA
Indica III  913 96.70% 0.70% 2.52% 0.11% NA
Indica Intermediate  786 84.60% 3.40% 11.45% 0.38% T: 0.13%
Temperate Japonica  767 26.60% 73.40% 0.00% 0.00% NA
Tropical Japonica  504 8.10% 88.10% 3.57% 0.20% NA
Japonica Intermediate  241 16.20% 82.60% 0.41% 0.83% NA
VI/Aromatic  96 10.40% 2.10% 66.67% 20.83% NA
Intermediate  90 50.00% 38.90% 7.78% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619650349 A -> C LOC_Os06g33780.1 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> C LOC_Os06g33790.1 upstream_gene_variant ; 3922.0bp to feature; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> C LOC_Os06g33770.1 downstream_gene_variant ; 2261.0bp to feature; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> C LOC_Os06g33770-LOC_Os06g33780 intergenic_region ; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> T LOC_Os06g33780.1 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> T LOC_Os06g33790.1 upstream_gene_variant ; 3922.0bp to feature; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> T LOC_Os06g33770.1 downstream_gene_variant ; 2261.0bp to feature; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> T LOC_Os06g33770-LOC_Os06g33780 intergenic_region ; MODIFIER silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0619650349 A -> DEL N N silent_mutation Average:32.818; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619650349 1.63E-07 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 4.50E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 1.91E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 1.05E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 9.63E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 1.03E-09 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 2.47E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 7.87E-07 1.78E-31 mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 4.62E-30 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 6.69E-08 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 6.41E-19 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 6.16E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 4.97E-08 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.71E-22 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.89E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 3.27E-06 3.33E-18 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.87E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 2.58E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.27E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 7.75E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.95E-20 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 7.53E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 8.99E-30 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 9.15E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.27E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 3.86E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.09E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 8.78E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.65E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 8.94E-17 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 9.57E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 1.36E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 8.31E-06 4.46E-24 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 3.03E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619650349 NA 2.81E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251