\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619609667:

Variant ID: vg0619609667 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 19609667
Reference Allele: AAlternative Allele: G,AAAGATGTCTCGTGTACGCTCCCACAGGAATTTATTTCTTCAATCG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAAAACCAAGACACGTGGCAATATTTTAGAGATGGCTAGCTCTTTTTTCCAGCCTGCCACGTGACCCAATAGCATGCTAAGATTAGCACCTTGCAATC[A/G,AAAGATGTCTCGTGTACGCTCCCACAGGAATTTATTTCTTCAATCG]
GATTTAGAGATTTTGGATACATTGTACATATAGAAGGCCAAATCAAAGCAAACCAGAGTTGAGTTTCAACGAAGGCATTAAAACTAAAAAAAAAATCAAT

Reverse complement sequence

ATTGATTTTTTTTTTAGTTTTAATGCCTTCGTTGAAACTCAACTCTGGTTTGCTTTGATTTGGCCTTCTATATGTACAATGTATCCAAAATCTCTAAATC[T/C,CGATTGAAGAAATAAATTCCTGTGGGAGCGTACACGAGACATCTTT]
GATTGCAAGGTGCTAATCTTAGCATGCTATTGGGTCACGTGGCAGGCTGGAAAAAAGAGCTAGCCATCTCTAAAATATTGCCACGTGTCTTGGTTTTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.70% 0.11% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 26.00% 73.70% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 29.30% 70.50% 0.13% 0.00% NA
Tropical Japonica  504 23.00% 76.20% 0.79% 0.00% NA
Japonica Intermediate  241 21.60% 78.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619609667 A -> G LOC_Os06g33690.1 upstream_gene_variant ; 3551.0bp to feature; MODIFIER silent_mutation Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> G LOC_Os06g33700.1 upstream_gene_variant ; 687.0bp to feature; MODIFIER silent_mutation Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> G LOC_Os06g33710.1 upstream_gene_variant ; 4605.0bp to feature; MODIFIER silent_mutation Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> G LOC_Os06g33710.2 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> G LOC_Os06g33710.3 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> G LOC_Os06g33710.4 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> G LOC_Os06g33690-LOC_Os06g33700 intergenic_region ; MODIFIER silent_mutation Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> AAAGATGTCTCGTGTACGCTCCCACAGGAA TTTATTTCTTCAATCG LOC_Os06g33690.1 upstream_gene_variant ; 3552.0bp to feature; MODIFIER N Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> AAAGATGTCTCGTGTACGCTCCCACAGGAA TTTATTTCTTCAATCG LOC_Os06g33700.1 upstream_gene_variant ; 686.0bp to feature; MODIFIER N Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> AAAGATGTCTCGTGTACGCTCCCACAGGAA TTTATTTCTTCAATCG LOC_Os06g33710.1 upstream_gene_variant ; 4604.0bp to feature; MODIFIER N Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> AAAGATGTCTCGTGTACGCTCCCACAGGAA TTTATTTCTTCAATCG LOC_Os06g33710.2 upstream_gene_variant ; 4646.0bp to feature; MODIFIER N Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> AAAGATGTCTCGTGTACGCTCCCACAGGAA TTTATTTCTTCAATCG LOC_Os06g33710.3 upstream_gene_variant ; 4646.0bp to feature; MODIFIER N Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> AAAGATGTCTCGTGTACGCTCCCACAGGAA TTTATTTCTTCAATCG LOC_Os06g33710.4 upstream_gene_variant ; 4646.0bp to feature; MODIFIER N Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N
vg0619609667 A -> AAAGATGTCTCGTGTACGCTCCCACAGGAA TTTATTTCTTCAATCG LOC_Os06g33690-LOC_Os06g33700 intergenic_region ; MODIFIER N Average:76.369; most accessible tissue: Minghui63 panicle, score: 95.529 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0619609667 A AAAGA* -0.14 -0.07 -0.05 0.08 0.04 0.02
vg0619609667 A G 0.01 0.01 0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619609667 2.20E-07 3.87E-31 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 8.18E-29 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 3.07E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 5.87E-07 2.71E-21 mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 2.05E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 1.46E-16 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 7.99E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 1.29E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 4.66E-07 7.14E-32 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 9.43E-07 5.64E-29 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 9.21E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 6.18E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 3.88E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 2.08E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 1.16E-06 7.22E-34 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 5.74E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 6.08E-23 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619609667 NA 2.33E-21 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251