\
| Variant ID: vg0619574951 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19574951 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 327. )
ACATAGGGGTGAGACCACCCGCTTACTAGTCCAGTGCCATGGCATCTCGACTAACGGACACCGGCCCGTGTAGCCTTCATTTGCCTAGACATCTCGATTA[C/T]
CGAGCCGCAGCTCGCATAGCCTTCATTTGCCTCAGAGATATCCATCGTCGCAACGACTTCATCCATCTCTCTCCGTGTCCTTTTGTTCAGGACTAGGCTG
CAGCCTAGTCCTGAACAAAAGGACACGGAGAGAGATGGATGAAGTCGTTGCGACGATGGATATCTCTGAGGCAAATGAAGGCTATGCGAGCTGCGGCTCG[G/A]
TAATCGAGATGTCTAGGCAAATGAAGGCTACACGGGCCGGTGTCCGTTAGTCGAGATGCCATGGCACTGGACTAGTAAGCGGGTGGTCTCACCCCTATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619574951 | C -> T | LOC_Os06g33620.1 | upstream_gene_variant ; 1681.0bp to feature; MODIFIER | silent_mutation | Average:56.66; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0619574951 | C -> T | LOC_Os06g33630.1 | downstream_gene_variant ; 3908.0bp to feature; MODIFIER | silent_mutation | Average:56.66; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0619574951 | C -> T | LOC_Os06g33610-LOC_Os06g33620 | intergenic_region ; MODIFIER | silent_mutation | Average:56.66; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619574951 | NA | 2.37E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619574951 | NA | 6.21E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619574951 | NA | 1.87E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619574951 | 2.51E-06 | 2.51E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619574951 | NA | 5.44E-07 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619574951 | 7.15E-06 | NA | mr1923_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |