Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619489522:

Variant ID: vg0619489522 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 19489522
Reference Allele: A	Alternative Allele: T,AGCGCCCGTTCCGTCATGGCGCCT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTGCGTCCATAGGCCCTAGGTGACATTCATCCTTCACAATCATATTGTGTTTTATAATACATCTCGTCATTATATTGATAATGCCCGATTGCTCCCAT[A/T,AGCGCCCGTTCCGTCATGGCGCCT]
AGTGAGTAAGAGTAGTGACCACCTCGAAACAGGCTATTAATATACCAAATGCACATTCAACATCTTTTCTCGTTGATTCTTGATGAAGAGGAAACATTTT

Reverse complement sequence

AAAATGTTTCCTCTTCATCAAGAATCAACGAGAAAAGATGTTGAATGTGCATTTGGTATATTAATAGCCTGTTTCGAGGTGGTCACTACTCTTACTCACT[T/A,AGGCGCCATGACGGAACGGGCGCT]
ATGGGAGCAATCGGGCATTATCAATATAATGACGAGATGTATTATAAAACACAATATGATTGTGAAGGATGAATGTCACCTAGGGCCTATGGACGCACAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.70%	46.60%	4.44%	0.19%	AGCGCCCGTTCCGTCATGGCGCCT: 0.04%
All Indica	2759	79.30%	13.10%	7.18%	0.33%	AGCGCCCGTTCCGTCATGGCGCCT: 0.07%
All Japonica	1512	4.30%	95.40%	0.26%	0.00%	NA
Aus	269	4.80%	93.70%	1.49%	0.00%	NA
Indica I	595	84.40%	9.70%	5.88%	0.00%	NA
Indica II	465	86.90%	7.30%	5.59%	0.22%	NA
Indica III	913	75.50%	14.60%	8.98%	0.88%	AGCGCCCGTTCCGTCATGGCGCCT: 0.11%
Indica Intermediate	786	75.60%	17.30%	7.00%	0.00%	AGCGCCCGTTCCGTCATGGCGCCT: 0.13%
Temperate Japonica	767	3.10%	96.60%	0.26%	0.00%	NA
Tropical Japonica	504	7.30%	92.30%	0.40%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	35.60%	60.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619489522	A -> T	LOC_Os06g33450.2	upstream_gene_variant ; 1007.0bp to feature; MODIFIER	silent_mutation	Average:53.842; most accessible tissue: Callus, score: 85.116	N	N	N	N
vg0619489522	A -> T	LOC_Os06g33450.1	upstream_gene_variant ; 1007.0bp to feature; MODIFIER	silent_mutation	Average:53.842; most accessible tissue: Callus, score: 85.116	N	N	N	N
vg0619489522	A -> T	LOC_Os06g33440-LOC_Os06g33450	intergenic_region ; MODIFIER	silent_mutation	Average:53.842; most accessible tissue: Callus, score: 85.116	N	N	N	N
vg0619489522	A -> DEL	N	N	silent_mutation	Average:53.842; most accessible tissue: Callus, score: 85.116	N	N	N	N
vg0619489522	A -> AGCGCCCGTTCCGTCATGGCGCCT	LOC_Os06g33450.2	upstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:53.842; most accessible tissue: Callus, score: 85.116	N	N	N	N
vg0619489522	A -> AGCGCCCGTTCCGTCATGGCGCCT	LOC_Os06g33450.1	upstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:53.842; most accessible tissue: Callus, score: 85.116	N	N	N	N
vg0619489522	A -> AGCGCCCGTTCCGTCATGGCGCCT	LOC_Os06g33440-LOC_Os06g33450	intergenic_region ; MODIFIER	silent_mutation	Average:53.842; most accessible tissue: Callus, score: 85.116	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619489522	NA	1.30E-07	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.85E-53	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.61E-43	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	6.44E-53	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.47E-55	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.12E-52	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.35E-38	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.51E-35	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.06E-46	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	4.36E-36	mr1110	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.04E-47	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.30E-48	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	8.31E-46	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	6.05E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.44E-27	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	4.75E-28	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.08E-45	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.24E-30	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	8.66E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	1.01E-21	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	8.59E-29	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	7.89E-44	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.69E-63	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	6.15E-45	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	9.01E-54	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.75E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	4.20E-53	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	5.34E-54	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	3.77E-09	mr1548_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619489522	NA	4.20E-22	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251