\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619430738:

Variant ID: vg0619430738 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19430738
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAAATCATTTTGTATTTGAAAATGTTGTTTGAAGTTGTCATATTTTGAAATTCAAATTCAAACTGTTCAAACAAAGTCATATAGAAAAAAGACCAATA[C/G]
AAAAGTTGTAGCTCTTGAAGAGTTATACAACTTTGTTGTTTATAACTTTTCTATTTGAAATCATTTACTATGTGAAAAAATTAGTTGAATTTCTTATATT

Reverse complement sequence

AATATAAGAAATTCAACTAATTTTTTCACATAGTAAATGATTTCAAATAGAAAAGTTATAAACAACAAAGTTGTATAACTCTTCAAGAGCTACAACTTTT[G/C]
TATTGGTCTTTTTTCTATATGACTTTGTTTGAACAGTTTGAATTTGAATTTCAAAATATGACAACTTCAAACAACATTTTCAAATACAAAATGATTTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 36.60% 5.76% 11.66% NA
All Indica  2759 72.20% 9.00% 8.08% 10.66% NA
All Japonica  1512 4.00% 94.20% 0.40% 1.39% NA
Aus  269 29.00% 6.70% 9.67% 54.65% NA
Indica I  595 76.10% 5.40% 4.54% 13.95% NA
Indica II  465 90.10% 5.20% 2.80% 1.94% NA
Indica III  913 65.60% 10.80% 11.17% 12.38% NA
Indica Intermediate  786 66.40% 12.00% 10.31% 11.32% NA
Temperate Japonica  767 3.40% 96.50% 0.00% 0.13% NA
Tropical Japonica  504 6.20% 89.50% 0.99% 3.37% NA
Japonica Intermediate  241 1.70% 96.70% 0.41% 1.24% NA
VI/Aromatic  96 5.20% 4.20% 9.38% 81.25% NA
Intermediate  90 42.20% 36.70% 8.89% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619430738 C -> G LOC_Os06g33360.1 upstream_gene_variant ; 4084.0bp to feature; MODIFIER silent_mutation Average:20.195; most accessible tissue: Callus, score: 40.022 N N N N
vg0619430738 C -> G LOC_Os06g33350.1 intron_variant ; MODIFIER silent_mutation Average:20.195; most accessible tissue: Callus, score: 40.022 N N N N
vg0619430738 C -> DEL N N silent_mutation Average:20.195; most accessible tissue: Callus, score: 40.022 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619430738 NA 8.52E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 2.17E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 5.34E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 1.80E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 2.32E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 3.23E-10 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 7.15E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 1.14E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 6.68E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 6.78E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 3.86E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 4.40E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 1.59E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 2.65E-06 mr1472_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 1.24E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 3.41E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 1.56E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 3.41E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738 NA 2.86E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251