Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619430738:

Variant ID: vg0619430738 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19430738
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGAAATCATTTTGTATTTGAAAATGTTGTTTGAAGTTGTCATATTTTGAAATTCAAATTCAAACTGTTCAAACAAAGTCATATAGAAAAAAGACCAATA[C/G]
AAAAGTTGTAGCTCTTGAAGAGTTATACAACTTTGTTGTTTATAACTTTTCTATTTGAAATCATTTACTATGTGAAAAAATTAGTTGAATTTCTTATATT

Reverse complement sequence

AATATAAGAAATTCAACTAATTTTTTCACATAGTAAATGATTTCAAATAGAAAAGTTATAAACAACAAAGTTGTATAACTCTTCAAGAGCTACAACTTTT[G/C]
TATTGGTCTTTTTTCTATATGACTTTGTTTGAACAGTTTGAATTTGAATTTCAAAATATGACAACTTCAAACAACATTTTCAAATACAAAATGATTTCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.00%	36.60%	5.76%	11.66%	NA
All Indica	2759	72.20%	9.00%	8.08%	10.66%	NA
All Japonica	1512	4.00%	94.20%	0.40%	1.39%	NA
Aus	269	29.00%	6.70%	9.67%	54.65%	NA
Indica I	595	76.10%	5.40%	4.54%	13.95%	NA
Indica II	465	90.10%	5.20%	2.80%	1.94%	NA
Indica III	913	65.60%	10.80%	11.17%	12.38%	NA
Indica Intermediate	786	66.40%	12.00%	10.31%	11.32%	NA
Temperate Japonica	767	3.40%	96.50%	0.00%	0.13%	NA
Tropical Japonica	504	6.20%	89.50%	0.99%	3.37%	NA
Japonica Intermediate	241	1.70%	96.70%	0.41%	1.24%	NA
VI/Aromatic	96	5.20%	4.20%	9.38%	81.25%	NA
Intermediate	90	42.20%	36.70%	8.89%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619430738	C -> G	LOC_Os06g33360.1	upstream_gene_variant ; 4084.0bp to feature; MODIFIER	silent_mutation	Average:20.195; most accessible tissue: Callus, score: 40.022	N	N	N	N
vg0619430738	C -> G	LOC_Os06g33350.1	intron_variant ; MODIFIER	silent_mutation	Average:20.195; most accessible tissue: Callus, score: 40.022	N	N	N	N
vg0619430738	C -> DEL	N	N	silent_mutation	Average:20.195; most accessible tissue: Callus, score: 40.022	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619430738	NA	8.52E-08	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	2.17E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	5.34E-07	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	1.80E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	2.32E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	3.23E-10	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	7.15E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	1.14E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	6.68E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	6.78E-07	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	3.86E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	4.40E-06	mr1439_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	1.59E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	2.65E-06	mr1472_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	1.24E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	3.41E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	1.56E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	3.41E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619430738	NA	2.86E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251