Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619424530:

Variant ID: vg0619424530 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19424530
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGGCGACAGGTGGTGACATCCCTGTCTGTCCTTTGTAATCCTCCATGCTCGGATACATTTTAGAGCTATAGGCCGGAGTCTCCTTGGCAGACTAGGGGT[A/G]
AACCGGTGCCCGAAGCAATCAATAGAGTTTTACCTTAACTTAATTAAGTTAATTAACCCATAGGAATTCTCTCCATCCCAAGCCTACCATTTAGTTATTG

Reverse complement sequence

CAATAACTAAATGGTAGGCTTGGGATGGAGAGAATTCCTATGGGTTAATTAACTTAATTAAGTTAAGGTAAAACTCTATTGATTGCTTCGGGCACCGGTT[T/C]
ACCCCTAGTCTGCCAAGGAGACTCCGGCCTATAGCTCTAAAATGTATCCGAGCATGGAGGATTACAAAGGACAGACAGGGATGTCACCACCTGTCGCCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	6.70%	1.29%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.04%	0.00%	NA
All Japonica	1512	79.40%	18.80%	1.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	0.40%	0.91%	0.00%	NA
Tropical Japonica	504	44.80%	52.20%	2.98%	0.00%	NA
Japonica Intermediate	241	90.00%	7.90%	2.07%	0.00%	NA
VI/Aromatic	96	70.80%	0.00%	29.17%	0.00%	NA
Intermediate	90	88.90%	5.60%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619424530	A -> G	LOC_Os06g33340.1	upstream_gene_variant ; 2637.0bp to feature; MODIFIER	silent_mutation	Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N
vg0619424530	A -> G	LOC_Os06g33340.3	upstream_gene_variant ; 2637.0bp to feature; MODIFIER	silent_mutation	Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N
vg0619424530	A -> G	LOC_Os06g33340.2	upstream_gene_variant ; 2637.0bp to feature; MODIFIER	silent_mutation	Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N
vg0619424530	A -> G	LOC_Os06g33350.1	downstream_gene_variant ; 3013.0bp to feature; MODIFIER	silent_mutation	Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N
vg0619424530	A -> G	LOC_Os06g33340-LOC_Os06g33350	intergenic_region ; MODIFIER	silent_mutation	Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619424530	7.65E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	NA	3.50E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	9.83E-06	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	2.34E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	NA	5.80E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	NA	3.55E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	NA	5.35E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	NA	1.16E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	1.78E-07	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	6.37E-08	NA	mr1085_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	5.21E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	3.36E-07	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	2.98E-06	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	NA	1.08E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	1.14E-06	1.29E-11	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	6.07E-06	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530	NA	2.72E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251