\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619424530:

Variant ID: vg0619424530 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19424530
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGCGACAGGTGGTGACATCCCTGTCTGTCCTTTGTAATCCTCCATGCTCGGATACATTTTAGAGCTATAGGCCGGAGTCTCCTTGGCAGACTAGGGGT[A/G]
AACCGGTGCCCGAAGCAATCAATAGAGTTTTACCTTAACTTAATTAAGTTAATTAACCCATAGGAATTCTCTCCATCCCAAGCCTACCATTTAGTTATTG

Reverse complement sequence

CAATAACTAAATGGTAGGCTTGGGATGGAGAGAATTCCTATGGGTTAATTAACTTAATTAAGTTAAGGTAAAACTCTATTGATTGCTTCGGGCACCGGTT[T/C]
ACCCCTAGTCTGCCAAGGAGACTCCGGCCTATAGCTCTAAAATGTATCCGAGCATGGAGGATTACAAAGGACAGACAGGGATGTCACCACCTGTCGCCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 6.70% 1.29% 0.00% NA
All Indica  2759 99.00% 1.00% 0.04% 0.00% NA
All Japonica  1512 79.40% 18.80% 1.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 0.40% 0.91% 0.00% NA
Tropical Japonica  504 44.80% 52.20% 2.98% 0.00% NA
Japonica Intermediate  241 90.00% 7.90% 2.07% 0.00% NA
VI/Aromatic  96 70.80% 0.00% 29.17% 0.00% NA
Intermediate  90 88.90% 5.60% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619424530 A -> G LOC_Os06g33340.1 upstream_gene_variant ; 2637.0bp to feature; MODIFIER silent_mutation Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg0619424530 A -> G LOC_Os06g33340.3 upstream_gene_variant ; 2637.0bp to feature; MODIFIER silent_mutation Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg0619424530 A -> G LOC_Os06g33340.2 upstream_gene_variant ; 2637.0bp to feature; MODIFIER silent_mutation Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg0619424530 A -> G LOC_Os06g33350.1 downstream_gene_variant ; 3013.0bp to feature; MODIFIER silent_mutation Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg0619424530 A -> G LOC_Os06g33340-LOC_Os06g33350 intergenic_region ; MODIFIER silent_mutation Average:61.63; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619424530 7.65E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 NA 3.50E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 9.83E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 2.34E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 NA 5.80E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 NA 3.55E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 NA 5.35E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 NA 1.16E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 1.78E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 6.37E-08 NA mr1085_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 5.21E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 3.36E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 2.98E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 NA 1.08E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 1.14E-06 1.29E-11 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 6.07E-06 NA mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619424530 NA 2.72E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251