\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619422571:

Variant ID: vg0619422571 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19422571
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGACCGCTCCGAGGTCATGCAATGGCTCAATGCCCAGCCTCGTCGGGGAGCCCGTCGACTAGTGGCTTTGCAACCTCCGTCGCATCTGGATCCATTT[C/A]
TGTCTCCTGCTCCTCCGTGGTGGCTTGCGGTGGCTTTTGGTATTTCTTAACCTCATAGATAAAATCCGCAAGCGCACGGAATATACCGATGTAGCACTTC

Reverse complement sequence

GAAGTGCTACATCGGTATATTCCGTGCGCTTGCGGATTTTATCTATGAGGTTAAGAAATACCAAAAGCCACCGCAAGCCACCACGGAGGAGCAGGAGACA[G/T]
AAATGGATCCAGATGCGACGGAGGTTGCAAAGCCACTAGTCGACGGGCTCCCCGACGAGGCTGGGCATTGAGCCATTGCATGACCTCGGAGCGGTCGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 6.80% 0.23% 1.74% NA
All Indica  2759 88.70% 11.00% 0.18% 0.07% NA
All Japonica  1512 99.40% 0.40% 0.00% 0.20% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 87.10% 12.60% 0.34% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 83.20% 16.60% 0.00% 0.11% NA
Indica Intermediate  786 90.20% 9.30% 0.38% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 15.60% 3.10% 6.25% 75.00% NA
Intermediate  90 93.30% 1.10% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619422571 C -> A LOC_Os06g33340.1 upstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619422571 C -> A LOC_Os06g33340.3 upstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619422571 C -> A LOC_Os06g33340.2 upstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619422571 C -> A LOC_Os06g33330.1 downstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619422571 C -> A LOC_Os06g33350.1 downstream_gene_variant ; 4972.0bp to feature; MODIFIER silent_mutation Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619422571 C -> A LOC_Os06g33340-LOC_Os06g33350 intergenic_region ; MODIFIER silent_mutation Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619422571 C -> DEL N N silent_mutation Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619422571 NA 1.23E-06 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 NA 1.31E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 NA 8.42E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 4.37E-06 3.38E-07 mr1502_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 NA 5.21E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 NA 6.47E-06 mr1742_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 4.84E-07 2.25E-08 mr1860_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 NA 2.13E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571 1.90E-06 1.90E-06 mr1912_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251