\
| Variant ID: vg0619422571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19422571 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCCGACCGCTCCGAGGTCATGCAATGGCTCAATGCCCAGCCTCGTCGGGGAGCCCGTCGACTAGTGGCTTTGCAACCTCCGTCGCATCTGGATCCATTT[C/A]
TGTCTCCTGCTCCTCCGTGGTGGCTTGCGGTGGCTTTTGGTATTTCTTAACCTCATAGATAAAATCCGCAAGCGCACGGAATATACCGATGTAGCACTTC
GAAGTGCTACATCGGTATATTCCGTGCGCTTGCGGATTTTATCTATGAGGTTAAGAAATACCAAAAGCCACCGCAAGCCACCACGGAGGAGCAGGAGACA[G/T]
AAATGGATCCAGATGCGACGGAGGTTGCAAAGCCACTAGTCGACGGGCTCCCCGACGAGGCTGGGCATTGAGCCATTGCATGACCTCGGAGCGGTCGGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 6.80% | 0.23% | 1.74% | NA |
| All Indica | 2759 | 88.70% | 11.00% | 0.18% | 0.07% | NA |
| All Japonica | 1512 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.10% | 12.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.20% | 16.60% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 90.20% | 9.30% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 15.60% | 3.10% | 6.25% | 75.00% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619422571 | C -> A | LOC_Os06g33340.1 | upstream_gene_variant ; 678.0bp to feature; MODIFIER | silent_mutation | Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0619422571 | C -> A | LOC_Os06g33340.3 | upstream_gene_variant ; 678.0bp to feature; MODIFIER | silent_mutation | Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0619422571 | C -> A | LOC_Os06g33340.2 | upstream_gene_variant ; 678.0bp to feature; MODIFIER | silent_mutation | Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0619422571 | C -> A | LOC_Os06g33330.1 | downstream_gene_variant ; 4078.0bp to feature; MODIFIER | silent_mutation | Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0619422571 | C -> A | LOC_Os06g33350.1 | downstream_gene_variant ; 4972.0bp to feature; MODIFIER | silent_mutation | Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0619422571 | C -> A | LOC_Os06g33340-LOC_Os06g33350 | intergenic_region ; MODIFIER | silent_mutation | Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0619422571 | C -> DEL | N | N | silent_mutation | Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619422571 | NA | 1.23E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | NA | 1.31E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | NA | 8.42E-06 | mr1479_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | 4.37E-06 | 3.38E-07 | mr1502_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | NA | 5.21E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | NA | 6.47E-06 | mr1742_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | 4.84E-07 | 2.25E-08 | mr1860_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | NA | 2.13E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619422571 | 1.90E-06 | 1.90E-06 | mr1912_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |