Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0619422571:

Variant ID: vg0619422571 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19422571
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGACCGCTCCGAGGTCATGCAATGGCTCAATGCCCAGCCTCGTCGGGGAGCCCGTCGACTAGTGGCTTTGCAACCTCCGTCGCATCTGGATCCATTT[C/A]
TGTCTCCTGCTCCTCCGTGGTGGCTTGCGGTGGCTTTTGGTATTTCTTAACCTCATAGATAAAATCCGCAAGCGCACGGAATATACCGATGTAGCACTTC

Reverse complement sequence

GAAGTGCTACATCGGTATATTCCGTGCGCTTGCGGATTTTATCTATGAGGTTAAGAAATACCAAAAGCCACCGCAAGCCACCACGGAGGAGCAGGAGACA[G/T]
AAATGGATCCAGATGCGACGGAGGTTGCAAAGCCACTAGTCGACGGGCTCCCCGACGAGGCTGGGCATTGAGCCATTGCATGACCTCGGAGCGGTCGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	6.80%	0.23%	1.74%	NA
All Indica	2759	88.70%	11.00%	0.18%	0.07%	NA
All Japonica	1512	99.40%	0.40%	0.00%	0.20%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	87.10%	12.60%	0.34%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	83.20%	16.60%	0.00%	0.11%	NA
Indica Intermediate	786	90.20%	9.30%	0.38%	0.13%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	15.60%	3.10%	6.25%	75.00%	NA
Intermediate	90	93.30%	1.10%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619422571	C -> A	LOC_Os06g33340.1	upstream_gene_variant ; 678.0bp to feature; MODIFIER	silent_mutation	Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0619422571	C -> A	LOC_Os06g33340.3	upstream_gene_variant ; 678.0bp to feature; MODIFIER	silent_mutation	Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0619422571	C -> A	LOC_Os06g33340.2	upstream_gene_variant ; 678.0bp to feature; MODIFIER	silent_mutation	Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0619422571	C -> A	LOC_Os06g33330.1	downstream_gene_variant ; 4078.0bp to feature; MODIFIER	silent_mutation	Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0619422571	C -> A	LOC_Os06g33350.1	downstream_gene_variant ; 4972.0bp to feature; MODIFIER	silent_mutation	Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0619422571	C -> A	LOC_Os06g33340-LOC_Os06g33350	intergenic_region ; MODIFIER	silent_mutation	Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0619422571	C -> DEL	N	N	silent_mutation	Average:78.809; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619422571	NA	1.23E-06	mr1043_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	NA	1.31E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	NA	8.42E-06	mr1479_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	4.37E-06	3.38E-07	mr1502_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	NA	5.21E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	NA	6.47E-06	mr1742_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	4.84E-07	2.25E-08	mr1860_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	NA	2.13E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619422571	1.90E-06	1.90E-06	mr1912_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251