\
| Variant ID: vg0619405763 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19405763 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATACTCCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCCCACATTCATATTGATATTAATGAATCTAAGACATATATATCCATCTAGATTCATTAA[C/T]
ATCCATATGAATGTGGGAAATACTAGAATGACTTATATTGTGAAACGGAGGAAGTACGTCATTATGGTGAACTAGTGAATAGAAATGATAGAAAAGCATT
AATGCTTTTCTATCATTTCTATTCACTAGTTCACCATAATGACGTACTTCCTCCGTTTCACAATATAAGTCATTCTAGTATTTCCCACATTCATATGGAT[G/A]
TTAATGAATCTAGATGGATATATATGTCTTAGATTCATTAATATCAATATGAATGTGGGAAATGCTAGAATGACTTACATTGTGAAACGGAGGGAGTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.70% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 92.30% | 5.40% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.80% | 6.90% | 4.30% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 11.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619405763 | C -> T | LOC_Os06g33320.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.261; most accessible tissue: Zhenshan97 flower, score: 68.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619405763 | NA | 7.51E-07 | mr1006_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | NA | 1.18E-06 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | 4.99E-06 | 4.71E-07 | mr1043_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | NA | 4.59E-07 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | 8.48E-06 | 1.01E-06 | mr1185_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | 3.22E-06 | 2.68E-07 | mr1269_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | 5.63E-07 | 2.66E-08 | mr1291_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | NA | 8.80E-08 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | 7.58E-07 | 6.34E-08 | mr1479_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | 1.50E-06 | 1.96E-07 | mr1677_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619405763 | NA | 1.01E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |