\
| Variant ID: vg0619397284 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19397284 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCTGTGATCATGCCTTAAGATTAAGGCTATCTGACTATGAAGCTTAAGGCTGTGTTTGACACATTGAGTTGGGGCTAATCCTTGATGCATACAAAATGG[G/A]
GTGACTCATTAGCACATGATTAATTAAGTATTAGCTATTTTTTAAAAAATAAATGGATTAATAGGATTTTTAAAAGCAACTTCCCTATTTTTTTTGAAAA
TTTTCAAAAAAAATAGGGAAGTTGCTTTTAAAAATCCTATTAATCCATTTATTTTTTAAAAAATAGCTAATACTTAATTAATCATGTGCTAATGAGTCAC[C/T]
CCATTTTGTATGCATCAAGGATTAGCCCCAACTCAATGTGTCAAACACAGCCTTAAGCTTCATAGTCAGATAGCCTTAATCTTAAGGCATGATCACAGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 17.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 83.70% | 16.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 78.30% | 21.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.00% | 14.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.30% | 18.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 67.00% | 33.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619397284 | G -> A | LOC_Os06g33320.1 | upstream_gene_variant ; 3732.0bp to feature; MODIFIER | silent_mutation | Average:60.227; most accessible tissue: Callus, score: 93.245 | N | N | N | N |
| vg0619397284 | G -> A | LOC_Os06g33310-LOC_Os06g33320 | intergenic_region ; MODIFIER | silent_mutation | Average:60.227; most accessible tissue: Callus, score: 93.245 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619397284 | NA | 2.41E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 4.61E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 2.09E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | 9.02E-06 | 1.49E-08 | mr1043_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 1.23E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 6.77E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 4.24E-06 | mr1185_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | 8.14E-06 | 4.72E-07 | mr1269_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | 1.53E-06 | 4.38E-08 | mr1291_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 5.71E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 3.15E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 1.73E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | 2.13E-06 | NA | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | 6.26E-06 | 3.48E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 5.76E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 9.50E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 4.41E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 1.94E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 9.05E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 1.18E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619397284 | NA | 7.05E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |