\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619396044:

Variant ID: vg0619396044 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19396044
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGGTTGCGTCGGCTGTCGTTGTCAGATCCACATGCGACGAAGAAGCGGCTGTCGACAGATGCATCTACGAGTGAAGCCGCCACTGCCACCGCGGATTT[T/G]
TCATGAGTAGCAGTGTCACCGCCGTCGTCAGCTCCACATCCACAGGCAACATCGCCGCCCGGGTCAACATCATCCTTCTCCCCCTATCTCACTAGAGTTG

Reverse complement sequence

CAACTCTAGTGAGATAGGGGGAGAAGGATGATGTTGACCCGGGCGGCGATGTTGCCTGTGGATGTGGAGCTGACGACGGCGGTGACACTGCTACTCATGA[A/C]
AAATCCGCGGTGGCAGTGGCGGCTTCACTCGTAGATGCATCTGTCGACAGCCGCTTCTTCGTCGCATGTGGATCTGACAACGACAGCCGACGCAACCTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 17.00% 0.04% 0.00% NA
All Indica  2759 83.90% 16.00% 0.07% 0.00% NA
All Japonica  1512 78.40% 21.60% 0.00% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 85.00% 14.80% 0.17% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 77.20% 22.80% 0.00% 0.00% NA
Indica Intermediate  786 82.10% 17.80% 0.13% 0.00% NA
Temperate Japonica  767 67.10% 32.90% 0.00% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619396044 T -> G LOC_Os06g33320.1 upstream_gene_variant ; 4972.0bp to feature; MODIFIER silent_mutation Average:77.668; most accessible tissue: Zhenshan97 young leaf, score: 87.299 N N N N
vg0619396044 T -> G LOC_Os06g33310-LOC_Os06g33320 intergenic_region ; MODIFIER silent_mutation Average:77.668; most accessible tissue: Zhenshan97 young leaf, score: 87.299 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619396044 NA 5.25E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 2.09E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 3.67E-08 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 1.23E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 6.77E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 1.42E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 6.29E-06 1.40E-07 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 5.71E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 1.73E-08 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 8.88E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 5.27E-06 NA mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 5.76E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 9.50E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 4.41E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 1.94E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 9.05E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 1.18E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619396044 NA 7.05E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251