\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619349707:

Variant ID: vg0619349707 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19349707
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.26, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCAATCAAAAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACATAATATCT[A/T]
GATAATCAAGCCATTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATCTAGTAACGGGATTTAGCCGATACCGGTAGAAACCCTAAAACGA

Reverse complement sequence

TCGTTTTAGGGTTTCTACCGGTATCGGCTAAATCCCGTTACTAGATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAATGGCTTGATTATC[T/A]
AGATATTATGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTTTTGATTGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.60% 0.00% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 6.00% 94.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 11.70% 88.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619349707 A -> T LOC_Os06g33210.1 upstream_gene_variant ; 4984.0bp to feature; MODIFIER silent_mutation Average:40.451; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0619349707 A -> T LOC_Os06g33230.1 upstream_gene_variant ; 1482.0bp to feature; MODIFIER silent_mutation Average:40.451; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0619349707 A -> T LOC_Os06g33220.1 downstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:40.451; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0619349707 A -> T LOC_Os06g33240.1 downstream_gene_variant ; 3923.0bp to feature; MODIFIER silent_mutation Average:40.451; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0619349707 A -> T LOC_Os06g33230-LOC_Os06g33240 intergenic_region ; MODIFIER silent_mutation Average:40.451; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619349707 NA 1.01E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 8.20E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 3.00E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 5.21E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 3.68E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 1.54E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 9.04E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 5.27E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 4.98E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 8.49E-10 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 2.96E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 2.72E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 7.99E-10 mr1810 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 1.48E-09 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619349707 NA 4.34E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251