\
| Variant ID: vg0619331736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19331736 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAGTAGGATTTTAAAATATACAAACAAGAAAAATGCCGGGATTGGCTGCCATGCTCTTATAGAACCCGCAATAATTTCAAAACACAGGAATATATACAA[T/G]
AATATGACTTTGGATGGTTCACTTGAAATAAACATAGGAATTTTTTAGGAAGTTTATTTGGGTCATAGAGAGATCAGGGGGGGAGGGGGGTAGAGAATGC
GCATTCTCTACCCCCCTCCCCCCCTGATCTCTCTATGACCCAAATAAACTTCCTAAAAAATTCCTATGTTTATTTCAAGTGAACCATCCAAAGTCATATT[A/C]
TTGTATATATTCCTGTGTTTTGAAATTATTGCGGGTTCTATAAGAGCATGGCAGCCAATCCCGGCATTTTTCTTGTTTGTATATTTTAAAATCCTACTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 24.70% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 80.70% | 19.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 77.10% | 22.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 34.20% | 65.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.30% | 18.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 71.30% | 28.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 81.20% | 18.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 67.10% | 32.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 97.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619331736 | T -> G | LOC_Os06g33200.1 | downstream_gene_variant ; 2086.0bp to feature; MODIFIER | silent_mutation | Average:28.878; most accessible tissue: Callus, score: 64.383 | N | N | N | N |
| vg0619331736 | T -> G | LOC_Os06g33190-LOC_Os06g33200 | intergenic_region ; MODIFIER | silent_mutation | Average:28.878; most accessible tissue: Callus, score: 64.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619331736 | NA | 5.46E-19 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0619331736 | NA | 2.84E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 2.96E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 8.55E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 5.21E-12 | mr1126_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 2.70E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 3.98E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 2.95E-06 | mr1346_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 1.05E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 8.45E-06 | mr1577_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 4.80E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 2.91E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 5.86E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 6.22E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 6.08E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 1.19E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 2.40E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619331736 | NA | 1.36E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |