\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619287097:

Variant ID: vg0619287097 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19287097
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCCAGAAGTTGAAGCCACCCAAGTAGGCAAGTAAACCAAGCATCCGTAGAGCTGAGGAATAAGTTCACTGGAGGTCCCTCAATTTAACAGCGAGATTT[C/T]
TTGAGCTCCCTTAACCACAAAACCATAAATGTGTACCCCTAAACTCACTCAAACCATTCACCGGAGGTCCCTCGGCAGTATTTTTGCCCGGTTTTGCTGA

Reverse complement sequence

TCAGCAAAACCGGGCAAAAATACTGCCGAGGGACCTCCGGTGAATGGTTTGAGTGAGTTTAGGGGTACACATTTATGGTTTTGTGGTTAAGGGAGCTCAA[G/A]
AAATCTCGCTGTTAAATTGAGGGACCTCCAGTGAACTTATTCCTCAGCTCTACGGATGCTTGGTTTACTTGCCTACTTGGGTGGCTTCAACTTCTGGGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 42.00% 0.34% 7.24% NA
All Indica  2759 76.80% 22.30% 0.40% 0.54% NA
All Japonica  1512 2.40% 76.10% 0.13% 21.36% NA
Aus  269 34.60% 65.40% 0.00% 0.00% NA
Indica I  595 79.70% 17.50% 0.84% 2.02% NA
Indica II  465 93.80% 6.00% 0.22% 0.00% NA
Indica III  913 71.60% 28.30% 0.11% 0.00% NA
Indica Intermediate  786 70.50% 28.60% 0.51% 0.38% NA
Temperate Japonica  767 3.40% 63.60% 0.26% 32.72% NA
Tropical Japonica  504 0.80% 95.80% 0.00% 3.37% NA
Japonica Intermediate  241 2.90% 74.30% 0.00% 22.82% NA
VI/Aromatic  96 94.80% 4.20% 0.00% 1.04% NA
Intermediate  90 51.10% 42.20% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619287097 C -> T LOC_Os06g33120.1 downstream_gene_variant ; 4736.0bp to feature; MODIFIER silent_mutation Average:83.769; most accessible tissue: Minghui63 panicle, score: 97.431 N N N N
vg0619287097 C -> T LOC_Os06g33130.1 downstream_gene_variant ; 1810.0bp to feature; MODIFIER silent_mutation Average:83.769; most accessible tissue: Minghui63 panicle, score: 97.431 N N N N
vg0619287097 C -> T LOC_Os06g33140.1 downstream_gene_variant ; 292.0bp to feature; MODIFIER silent_mutation Average:83.769; most accessible tissue: Minghui63 panicle, score: 97.431 N N N N
vg0619287097 C -> T LOC_Os06g33130-LOC_Os06g33140 intergenic_region ; MODIFIER silent_mutation Average:83.769; most accessible tissue: Minghui63 panicle, score: 97.431 N N N N
vg0619287097 C -> DEL N N silent_mutation Average:83.769; most accessible tissue: Minghui63 panicle, score: 97.431 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0619287097 C T -0.06 -0.04 -0.03 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619287097 NA 2.48E-16 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 5.25E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 5.54E-16 mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 2.01E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 1.37E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 3.96E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 5.19E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 1.23E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 8.86E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 4.02E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 2.13E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 9.67E-06 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 1.38E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 8.64E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 2.84E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 3.20E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 2.83E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 3.17E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 7.27E-14 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 3.24E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 3.22E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 2.44E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 9.39E-09 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 6.77E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 3.17E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 6.84E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 7.40E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619287097 NA 4.56E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251