\
| Variant ID: vg0619281480 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19281480 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 272. )
GTTGCAGAAATTTATGTTGAGCATATAGCAATTGATGAGGGGCAAGATGATAATTAGATTGCTGATTGGGGCTATGACATGGCAGAAGCTAACGATGAAG[C/T]
GAAATCAGATTCAGAGGCAGAGCTACATCTTACTGTTGTTCTATGTACAGATAAGAAGGGAAAATTGAAACCAAGAAGAGCATCATCTCAAATTCTAGAG
CTCTAGAATTTGAGATGATGCTCTTCTTGGTTTCAATTTTCCCTTCTTATCTGTACATAGAACAACAGTAAGATGTAGCTCTGCCTCTGAATCTGATTTC[G/A]
CTTCATCGTTAGCTTCTGCCATGTCATAGCCCCAATCAGCAATCTAATTATCATCTTGCCCCTCATCAATTGCTATATGCTCAACATAAATTTCTGCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619281480 | C -> T | LOC_Os06g33120.1 | missense_variant ; p.Ala8Val; MODERATE | nonsynonymous_codon ; A8V | Average:47.072; most accessible tissue: Zhenshan97 root, score: 60.612 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619281480 | NA | 5.60E-11 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 2.09E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 1.23E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 6.77E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 5.71E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 1.63E-10 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 1.73E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | 3.41E-07 | NA | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 5.76E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 9.50E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 4.41E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 1.94E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 9.05E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 1.18E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619281480 | NA | 7.05E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |