\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619275607:

Variant ID: vg0619275607 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19275607
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCGTGCCTCCTAGCGCCGCCGCGACGCGCTCCAAGTCCGCCGCCGCCGCCGGCCGTCTTCGGTCACGTCGCCGCGCCGTCTCCGCCGTCGCCGCCGC[T/A]
TGCCGTCATCGCCGTTAGGTGCGCCGTGGTGAGAGGAACCTCGGCTGCCCCTCCTCTTTCGCCGCCGACCACCGGAGCCCCTCCGCCGCCGTCGACCCGA

Reverse complement sequence

TCGGGTCGACGGCGGCGGAGGGGCTCCGGTGGTCGGCGGCGAAAGAGGAGGGGCAGCCGAGGTTCCTCTCACCACGGCGCACCTAACGGCGATGACGGCA[A/T]
GCGGCGGCGACGGCGGAGACGGCGCGGCGACGTGACCGAAGACGGCCGGCGGCGGCGGCGGACTTGGAGCGCGTCGCGGCGGCGCTAGGAGGCACGGGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 0.40% 1.90% 4.46% NA
All Indica  2759 93.60% 0.00% 0.87% 5.51% NA
All Japonica  1512 91.10% 1.30% 4.10% 3.51% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 0.00% 0.50% 4.03% NA
Indica II  465 84.70% 0.00% 1.29% 13.98% NA
Indica III  913 98.00% 0.00% 0.66% 1.31% NA
Indica Intermediate  786 92.40% 0.00% 1.15% 6.49% NA
Temperate Japonica  767 90.00% 1.20% 6.26% 2.61% NA
Tropical Japonica  504 92.70% 0.80% 1.19% 5.36% NA
Japonica Intermediate  241 91.70% 2.50% 3.32% 2.49% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 88.90% 1.10% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619275607 T -> A LOC_Os06g33100.1 upstream_gene_variant ; 2716.0bp to feature; MODIFIER silent_mutation Average:92.657; most accessible tissue: Zhenshan97 flag leaf, score: 99.929 N N N N
vg0619275607 T -> A LOC_Os06g33110.1 intron_variant ; MODIFIER silent_mutation Average:92.657; most accessible tissue: Zhenshan97 flag leaf, score: 99.929 N N N N
vg0619275607 T -> DEL N N silent_mutation Average:92.657; most accessible tissue: Zhenshan97 flag leaf, score: 99.929 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0619275607 T A 0.01 -0.01 0.0 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619275607 NA 4.03E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 NA 1.02E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 2.54E-06 2.54E-06 mr1108_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 NA 2.32E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 NA 6.10E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 NA 9.51E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 NA 6.50E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 NA 4.22E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 NA 4.31E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619275607 7.81E-06 7.81E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251