\
| Variant ID: vg0619254847 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19254847 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 122. )
CAGCATAGTGTGTCCTACTAGCGAGAGTCCACCCAACTTTCGCTCCTGAAGTCGCTGAGGGCATGGATTTCAAGCCCTCGGTTACAGACAAGGTCCACGG[C/T]
GCAGACCTGCTAGCTGGGTATACCAAGGTGTCCATCGATACAGTAAAGGACACCTGGTCAGGCTATCCGCTGCCCGTGCCCCCCAATGATGAAATCATGA
TCATGATTTCATCATTGGGGGGCACGGGCAGCGGATAGCCTGACCAGGTGTCCTTTACTGTATCGATGGACACCTTGGTATACCCAGCTAGCAGGTCTGC[G/A]
CCGTGGACCTTGTCTGTAACCGAGGGCTTGAAATCCATGCCCTCAGCGACTTCAGGAGCGAAAGTTGGGTGGACTCTCGCTAGTAGGACACACTATGCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 3.50% | 1.21% | 4.25% | NA |
| All Indica | 2759 | 93.30% | 5.20% | 1.49% | 0.00% | NA |
| All Japonica | 1512 | 85.10% | 0.70% | 1.06% | 13.16% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 91.20% | 6.50% | 2.37% | 0.00% | NA |
| Indica III | 913 | 89.00% | 9.10% | 1.86% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 3.80% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 77.40% | 1.20% | 1.17% | 20.21% | NA |
| Tropical Japonica | 504 | 97.40% | 0.20% | 0.60% | 1.79% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.40% | 1.66% | 14.52% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619254847 | C -> T | LOC_Os06g33070.1 | synonymous_variant ; p.Gly447Gly; LOW | synonymous_codon | Average:44.678; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0619254847 | C -> DEL | LOC_Os06g33070.1 | N | frameshift_variant | Average:44.678; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619254847 | 4.00E-06 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 2.23E-06 | 6.16E-09 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 5.14E-07 | 2.11E-09 | mr1121 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 4.63E-06 | 1.15E-09 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 6.76E-08 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 3.34E-08 | 2.56E-09 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 5.18E-06 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 4.23E-08 | 8.45E-10 | mr1121_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 3.19E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254847 | 1.23E-08 | 3.13E-11 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |