\
| Variant ID: vg0619254766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19254766 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTGATGTTATCCGATCCATATCTAATAAAAAACCTTTACACGTTCCAATATTAAATTCAAACTTTCACATATGCAAGGCGCAGCATAGTGTGTCCTACT[A/G]
GCGAGAGTCCACCCAACTTTCGCTCCTGAAGTCGCTGAGGGCATGGATTTCAAGCCCTCGGTTACAGACAAGGTCCACGGCGCAGACCTGCTAGCTGGGT
ACCCAGCTAGCAGGTCTGCGCCGTGGACCTTGTCTGTAACCGAGGGCTTGAAATCCATGCCCTCAGCGACTTCAGGAGCGAAAGTTGGGTGGACTCTCGC[T/C]
AGTAGGACACACTATGCTGCGCCTTGCATATGTGAAAGTTTGAATTTAATATTGGAACGTGTAAAGGTTTTTTATTAGATATGGATCGGATAACATCAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 28.30% | 0.13% | 6.12% | NA |
| All Indica | 2759 | 93.40% | 6.20% | 0.04% | 0.40% | NA |
| All Japonica | 1512 | 6.50% | 75.10% | 0.26% | 18.19% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.30% | 6.40% | 0.00% | 1.34% | NA |
| Indica II | 465 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 10.60% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 3.70% | 68.70% | 0.52% | 27.12% | NA |
| Tropical Japonica | 504 | 11.70% | 84.90% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 4.60% | 74.70% | 0.00% | 20.75% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 33.30% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619254766 | A -> G | LOC_Os06g33070.1 | synonymous_variant ; p.Leu420Leu; LOW | synonymous_codon | Average:47.271; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0619254766 | A -> DEL | LOC_Os06g33070.1 | N | frameshift_variant | Average:47.271; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619254766 | NA | 2.79E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 1.13E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 7.61E-07 | mr1528 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 7.46E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 8.07E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 1.32E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 2.14E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 4.71E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619254766 | NA | 1.01E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |