Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619248810:

Variant ID: vg0619248810 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19248810
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

GCCCTTGGCAACCTTTCTGGCCAAACTGTGAAAGGGAAATGGGCGTGTTCGGAGTGTATGGAGGAAACAAGAAGCAAATGGTTGAAGCATTCACACAAGA[C/T]
GGTCTACATGGGTCACAGGAGATTTCTCTCAAGGTATCACCCGTATAGGAATATGAGAAAGAATTTCAATGGACACAGAGATACAGCCGGACCCCCGGCA

Reverse complement sequence

TGCCGGGGGTCCGGCTGTATCTCTGTGTCCATTGAAATTCTTTCTCATATTCCTATACGGGTGATACCTTGAGAGAAATCTCCTGTGACCCATGTAGACC[G/A]
TCTTGTGTGAATGCTTCAACCATTTGCTTCTTGTTTCCTCCATACACTCCGAACACGCCCATTTCCCTTTCACAGTTTGGCCAGAAAGGTTGCCAAGGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	7.00%	1.65%	4.95%	NA
All Indica	2759	85.80%	11.50%	2.46%	0.18%	NA
All Japonica	1512	83.80%	0.70%	0.46%	15.08%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.80%	1.80%	3.87%	0.50%	NA
Indica II	465	52.70%	41.50%	5.81%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	83.60%	13.90%	2.29%	0.25%	NA
Temperate Japonica	767	76.10%	0.80%	0.52%	22.56%	NA
Tropical Japonica	504	97.20%	0.40%	0.00%	2.38%	NA
Japonica Intermediate	241	80.10%	0.80%	1.24%	17.84%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	5.60%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619248810	C -> T	LOC_Os06g33050.1	missense_variant ; p.Thr490Met; MODERATE	nonsynonymous_codon ; T490M	Average:26.72; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	benign	0.988	TOLERATED	0.52
vg0619248810	C -> DEL	LOC_Os06g33050.1	N	frameshift_variant	Average:26.72; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619248810	NA	6.14E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	3.44E-07	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	4.38E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	4.66E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	2.00E-09	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	1.02E-26	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	1.13E-14	mr1877	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	8.17E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	8.70E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	1.31E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	4.12E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	4.98E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	3.69E-07	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	8.66E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	1.89E-08	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	4.48E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	6.99E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	5.95E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	2.63E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	9.95E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	6.79E-06	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	6.00E-08	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	8.29E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	1.71E-06	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	3.53E-06	mr1928_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	1.29E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	8.47E-07	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	3.15E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619248810	NA	1.92E-06	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251