\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619241795:

Variant ID: vg0619241795 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19241795
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ACACCAACCTAACCTGACAACGTATGCCGTGTCATATTGTCAGATTCGGCTCAATCGGCTAACCCTGTCCGACTCGAACTCTGCCGATCCTAGTCGCAGC[C/T]
GATTTGGACCTCAGCCGATCCTTACTCTGTTTCTAGGACGATCTCTATCTCGAACTCCGTCTCGACTCCTTTTTCACATCCGATCCTTGGATTACCAAAT

Reverse complement sequence

ATTTGGTAATCCAAGGATCGGATGTGAAAAAGGAGTCGAGACGGAGTTCGAGATAGAGATCGTCCTAGAAACAGAGTAAGGATCGGCTGAGGTCCAAATC[G/A]
GCTGCGACTAGGATCGGCAGAGTTCGAGTCGGACAGGGTTAGCCGATTGAGCCGAATCTGACAATATGACACGGCATACGTTGTCAGGTTAGGTTGGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 45.30% 0.15% 6.43% NA
All Indica  2759 76.20% 23.20% 0.11% 0.58% NA
All Japonica  1512 2.40% 78.80% 0.20% 18.58% NA
Aus  269 34.90% 65.10% 0.00% 0.00% NA
Indica I  595 79.00% 19.20% 0.50% 1.34% NA
Indica II  465 93.80% 5.80% 0.00% 0.43% NA
Indica III  913 70.00% 29.80% 0.00% 0.22% NA
Indica Intermediate  786 70.70% 28.80% 0.00% 0.51% NA
Temperate Japonica  767 3.40% 68.40% 0.26% 27.90% NA
Tropical Japonica  504 0.80% 95.80% 0.00% 3.37% NA
Japonica Intermediate  241 2.90% 75.90% 0.41% 20.75% NA
VI/Aromatic  96 1.00% 96.90% 1.04% 1.04% NA
Intermediate  90 43.30% 50.00% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619241795 C -> T LOC_Os06g33050.1 upstream_gene_variant ; 4895.0bp to feature; MODIFIER silent_mutation Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0619241795 C -> T LOC_Os06g33040-LOC_Os06g33050 intergenic_region ; MODIFIER silent_mutation Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0619241795 C -> DEL N N silent_mutation Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619241795 NA 5.79E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795 NA 2.79E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795 NA 1.77E-06 mr1167_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795 NA 3.58E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795 NA 8.09E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795 NA 4.72E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795 NA 6.70E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795 NA 2.80E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251