\
| Variant ID: vg0619241795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19241795 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 222. )
ACACCAACCTAACCTGACAACGTATGCCGTGTCATATTGTCAGATTCGGCTCAATCGGCTAACCCTGTCCGACTCGAACTCTGCCGATCCTAGTCGCAGC[C/T]
GATTTGGACCTCAGCCGATCCTTACTCTGTTTCTAGGACGATCTCTATCTCGAACTCCGTCTCGACTCCTTTTTCACATCCGATCCTTGGATTACCAAAT
ATTTGGTAATCCAAGGATCGGATGTGAAAAAGGAGTCGAGACGGAGTTCGAGATAGAGATCGTCCTAGAAACAGAGTAAGGATCGGCTGAGGTCCAAATC[G/A]
GCTGCGACTAGGATCGGCAGAGTTCGAGTCGGACAGGGTTAGCCGATTGAGCCGAATCTGACAATATGACACGGCATACGTTGTCAGGTTAGGTTGGTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.10% | 45.30% | 0.15% | 6.43% | NA |
| All Indica | 2759 | 76.20% | 23.20% | 0.11% | 0.58% | NA |
| All Japonica | 1512 | 2.40% | 78.80% | 0.20% | 18.58% | NA |
| Aus | 269 | 34.90% | 65.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.00% | 19.20% | 0.50% | 1.34% | NA |
| Indica II | 465 | 93.80% | 5.80% | 0.00% | 0.43% | NA |
| Indica III | 913 | 70.00% | 29.80% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 70.70% | 28.80% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 3.40% | 68.40% | 0.26% | 27.90% | NA |
| Tropical Japonica | 504 | 0.80% | 95.80% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 2.90% | 75.90% | 0.41% | 20.75% | NA |
| VI/Aromatic | 96 | 1.00% | 96.90% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 43.30% | 50.00% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619241795 | C -> T | LOC_Os06g33050.1 | upstream_gene_variant ; 4895.0bp to feature; MODIFIER | silent_mutation | Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| vg0619241795 | C -> T | LOC_Os06g33040-LOC_Os06g33050 | intergenic_region ; MODIFIER | silent_mutation | Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| vg0619241795 | C -> DEL | N | N | silent_mutation | Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619241795 | NA | 5.79E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619241795 | NA | 2.79E-07 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619241795 | NA | 1.77E-06 | mr1167_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619241795 | NA | 3.58E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619241795 | NA | 8.09E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619241795 | NA | 4.72E-07 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619241795 | NA | 6.70E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619241795 | NA | 2.80E-06 | mr1479_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |