\
| Variant ID: vg0619238891 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19238891 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTATAAAACCTTTCCATTTATTTTATGTAATCTCTAACTTTGGCTCTAAATTATATTTCCTTTGAATCCATTCCCGAACACCTCCAACAAATACCCTTT[C/G]
AATTCCCGTTCAACCATCTCTAGAGCACATGAAATATCAATCTCTCTAGAGTTAATACCTTTTTATTTCGAGCTTACCACACTACCACCAAATCCAGTTT
AAACTGGATTTGGTGGTAGTGTGGTAAGCTCGAAATAAAAAGGTATTAACTCTAGAGAGATTGATATTTCATGTGCTCTAGAGATGGTTGAACGGGAATT[G/C]
AAAGGGTATTTGTTGGAGGTGTTCGGGAATGGATTCAAAGGAAATATAATTTAGAGCCAAAGTTAGAGATTACATAAAATAAATGGAAAGGTTTTATAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 0.10% | 0.53% | 4.32% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| All Japonica | 1512 | 85.10% | 0.30% | 1.59% | 13.03% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.00% | 0.67% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 76.80% | 0.50% | 2.35% | 20.34% | NA |
| Tropical Japonica | 504 | 98.60% | 0.20% | 0.20% | 0.99% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.00% | 2.07% | 14.94% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619238891 | C -> G | LOC_Os06g33040.1 | upstream_gene_variant ; 4082.0bp to feature; MODIFIER | silent_mutation | Average:35.881; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0619238891 | C -> G | LOC_Os06g33040-LOC_Os06g33050 | intergenic_region ; MODIFIER | silent_mutation | Average:35.881; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0619238891 | C -> DEL | N | N | silent_mutation | Average:35.881; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619238891 | 1.36E-06 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 1.64E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 7.88E-08 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 9.38E-06 | mr1126_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 4.73E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 8.36E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 1.74E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 8.90E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619238891 | NA | 3.13E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |