Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619197342:

Variant ID: vg0619197342 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19197342
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTGAGTCGGATTATAAGTTTATTCGCTTTTGGAAATACATATCTGTCAACGTTTGATGTCGCGATTCCGGTATTTGCACAGTATGGGGATCGTTGGTA[C/T]
TAGGATATATGCGAGACCGAGGTAAAAGAGATGGAGACAAGGATTTTTATACAGGTTCGGGCCCCTGAATTATCAGGTAATAGCCCTACATCCTGTTGGC

Reverse complement sequence

GCCAACAGGATGTAGGGCTATTACCTGATAATTCAGGGGCCCGAACCTGTATAAAAATCCTTGTCTCCATCTCTTTTACCTCGGTCTCGCATATATCCTA[G/A]
TACCAACGATCCCCATACTGTGCAAATACCGGAATCGCGACATCAAACGTTGACAGATATGTATTTCCAAAAGCGAATAAACTTATAATCCGACTCACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	7.10%	0.17%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	80.20%	19.50%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	70.30%	29.60%	0.13%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	21.20%	1.66%	0.00%	NA
VI/Aromatic	96	81.20%	17.70%	1.04%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619197342	C -> T	LOC_Os06g32944.1	upstream_gene_variant ; 4944.0bp to feature; MODIFIER	silent_mutation	Average:56.742; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg0619197342	C -> T	LOC_Os06g32970.1	upstream_gene_variant ; 852.0bp to feature; MODIFIER	silent_mutation	Average:56.742; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg0619197342	C -> T	LOC_Os06g32960.1	downstream_gene_variant ; 1833.0bp to feature; MODIFIER	silent_mutation	Average:56.742; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg0619197342	C -> T	LOC_Os06g32980.1	downstream_gene_variant ; 2262.0bp to feature; MODIFIER	silent_mutation	Average:56.742; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg0619197342	C -> T	LOC_Os06g32970-LOC_Os06g32980	intergenic_region ; MODIFIER	silent_mutation	Average:56.742; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619197342	1.41E-06	4.18E-31	Awn_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0619197342	NA	2.09E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	1.82E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	1.23E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	6.77E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	5.71E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	3.33E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	1.73E-08	mr1624_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	5.76E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	9.50E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	4.41E-06	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	1.94E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	9.05E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	1.18E-07	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619197342	NA	7.05E-06	mr1792_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251