\
| Variant ID: vg0619193486 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19193486 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCCGTTACCCCAACCGTAAGGAAAAATAGTGTTATTTTCACCTGCGGTCCTTTTAGGACGAGCACTTATATAAGTTGATTGTCGCAAGTCGTTACTCCCT[C/T]
CGTCTCATAATATAAGGGATTTTGAGTTTTTGCTTGCACGATTTGACTACTCGTCTTATTTAAAAAATTTTGGAATTATTATTTACTTTTTTGTGACTTA
TAAGTCACAAAAAAGTAAATAATAATTCCAAAATTTTTTAAATAAGACGAGTAGTCAAATCGTGCAAGCAAAAACTCAAAATCCCTTATATTATGAGACG[G/A]
AGGGAGTAACGACTTGCGACAATCAACTTATATAAGTGCTCGTCCTAAAAGGACCGCAGGTGAAAATAACACTATTTTTCCTTACGGTTGGGGTAACGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 5.70% | 0.34% | 5.50% | NA |
| All Indica | 2759 | 91.00% | 8.50% | 0.22% | 0.25% | NA |
| All Japonica | 1512 | 82.40% | 0.50% | 0.66% | 16.47% | NA |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.70% | 12.60% | 0.67% | 1.01% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.00% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 74.70% | 0.10% | 0.91% | 24.25% | NA |
| Tropical Japonica | 504 | 95.60% | 1.00% | 0.20% | 3.17% | NA |
| Japonica Intermediate | 241 | 79.30% | 0.40% | 0.83% | 19.50% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619193486 | C -> T | LOC_Os06g32944.1 | upstream_gene_variant ; 1088.0bp to feature; MODIFIER | silent_mutation | Average:37.68; most accessible tissue: Callus, score: 63.411 | N | N | N | N |
| vg0619193486 | C -> T | LOC_Os06g32960.1 | upstream_gene_variant ; 972.0bp to feature; MODIFIER | silent_mutation | Average:37.68; most accessible tissue: Callus, score: 63.411 | N | N | N | N |
| vg0619193486 | C -> T | LOC_Os06g32970.1 | downstream_gene_variant ; 2288.0bp to feature; MODIFIER | silent_mutation | Average:37.68; most accessible tissue: Callus, score: 63.411 | N | N | N | N |
| vg0619193486 | C -> T | LOC_Os06g32944-LOC_Os06g32960 | intergenic_region ; MODIFIER | silent_mutation | Average:37.68; most accessible tissue: Callus, score: 63.411 | N | N | N | N |
| vg0619193486 | C -> DEL | N | N | silent_mutation | Average:37.68; most accessible tissue: Callus, score: 63.411 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619193486 | NA | 3.18E-07 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 2.16E-07 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 9.69E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 1.61E-07 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 7.50E-08 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | 3.91E-06 | 8.60E-08 | mr1043_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 2.87E-06 | mr1291_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 3.87E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 1.30E-08 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 9.51E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619193486 | NA | 2.16E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |