Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619193486:

Variant ID: vg0619193486 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19193486
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCGTTACCCCAACCGTAAGGAAAAATAGTGTTATTTTCACCTGCGGTCCTTTTAGGACGAGCACTTATATAAGTTGATTGTCGCAAGTCGTTACTCCCT[C/T]
CGTCTCATAATATAAGGGATTTTGAGTTTTTGCTTGCACGATTTGACTACTCGTCTTATTTAAAAAATTTTGGAATTATTATTTACTTTTTTGTGACTTA

Reverse complement sequence

TAAGTCACAAAAAAGTAAATAATAATTCCAAAATTTTTTAAATAAGACGAGTAGTCAAATCGTGCAAGCAAAAACTCAAAATCCCTTATATTATGAGACG[G/A]
AGGGAGTAACGACTTGCGACAATCAACTTATATAAGTGCTCGTCCTAAAAGGACCGCAGGTGAAAATAACACTATTTTTCCTTACGGTTGGGGTAACGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	5.70%	0.34%	5.50%	NA
All Indica	2759	91.00%	8.50%	0.22%	0.25%	NA
All Japonica	1512	82.40%	0.50%	0.66%	16.47%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	85.70%	12.60%	0.67%	1.01%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	89.30%	10.70%	0.00%	0.00%	NA
Indica Intermediate	786	92.60%	7.00%	0.25%	0.13%	NA
Temperate Japonica	767	74.70%	0.10%	0.91%	24.25%	NA
Tropical Japonica	504	95.60%	1.00%	0.20%	3.17%	NA
Japonica Intermediate	241	79.30%	0.40%	0.83%	19.50%	NA
VI/Aromatic	96	96.90%	2.10%	0.00%	1.04%	NA
Intermediate	90	95.60%	1.10%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619193486	C -> T	LOC_Os06g32944.1	upstream_gene_variant ; 1088.0bp to feature; MODIFIER	silent_mutation	Average:37.68; most accessible tissue: Callus, score: 63.411	N	N	N	N
vg0619193486	C -> T	LOC_Os06g32960.1	upstream_gene_variant ; 972.0bp to feature; MODIFIER	silent_mutation	Average:37.68; most accessible tissue: Callus, score: 63.411	N	N	N	N
vg0619193486	C -> T	LOC_Os06g32970.1	downstream_gene_variant ; 2288.0bp to feature; MODIFIER	silent_mutation	Average:37.68; most accessible tissue: Callus, score: 63.411	N	N	N	N
vg0619193486	C -> T	LOC_Os06g32944-LOC_Os06g32960	intergenic_region ; MODIFIER	silent_mutation	Average:37.68; most accessible tissue: Callus, score: 63.411	N	N	N	N
vg0619193486	C -> DEL	N	N	silent_mutation	Average:37.68; most accessible tissue: Callus, score: 63.411	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619193486	NA	3.18E-07	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	2.16E-07	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	9.69E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	1.61E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	7.50E-08	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	3.91E-06	8.60E-08	mr1043_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	2.87E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	3.87E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	1.30E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	9.51E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486	NA	2.16E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251