\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619193486:

Variant ID: vg0619193486 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19193486
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCGTTACCCCAACCGTAAGGAAAAATAGTGTTATTTTCACCTGCGGTCCTTTTAGGACGAGCACTTATATAAGTTGATTGTCGCAAGTCGTTACTCCCT[C/T]
CGTCTCATAATATAAGGGATTTTGAGTTTTTGCTTGCACGATTTGACTACTCGTCTTATTTAAAAAATTTTGGAATTATTATTTACTTTTTTGTGACTTA

Reverse complement sequence

TAAGTCACAAAAAAGTAAATAATAATTCCAAAATTTTTTAAATAAGACGAGTAGTCAAATCGTGCAAGCAAAAACTCAAAATCCCTTATATTATGAGACG[G/A]
AGGGAGTAACGACTTGCGACAATCAACTTATATAAGTGCTCGTCCTAAAAGGACCGCAGGTGAAAATAACACTATTTTTCCTTACGGTTGGGGTAACGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 5.70% 0.34% 5.50% NA
All Indica  2759 91.00% 8.50% 0.22% 0.25% NA
All Japonica  1512 82.40% 0.50% 0.66% 16.47% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 85.70% 12.60% 0.67% 1.01% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 89.30% 10.70% 0.00% 0.00% NA
Indica Intermediate  786 92.60% 7.00% 0.25% 0.13% NA
Temperate Japonica  767 74.70% 0.10% 0.91% 24.25% NA
Tropical Japonica  504 95.60% 1.00% 0.20% 3.17% NA
Japonica Intermediate  241 79.30% 0.40% 0.83% 19.50% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 95.60% 1.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619193486 C -> T LOC_Os06g32944.1 upstream_gene_variant ; 1088.0bp to feature; MODIFIER silent_mutation Average:37.68; most accessible tissue: Callus, score: 63.411 N N N N
vg0619193486 C -> T LOC_Os06g32960.1 upstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:37.68; most accessible tissue: Callus, score: 63.411 N N N N
vg0619193486 C -> T LOC_Os06g32970.1 downstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:37.68; most accessible tissue: Callus, score: 63.411 N N N N
vg0619193486 C -> T LOC_Os06g32944-LOC_Os06g32960 intergenic_region ; MODIFIER silent_mutation Average:37.68; most accessible tissue: Callus, score: 63.411 N N N N
vg0619193486 C -> DEL N N silent_mutation Average:37.68; most accessible tissue: Callus, score: 63.411 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619193486 NA 3.18E-07 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 2.16E-07 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 9.69E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 1.61E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 7.50E-08 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 3.91E-06 8.60E-08 mr1043_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 2.87E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 3.87E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 1.30E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 9.51E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619193486 NA 2.16E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251