\
| Variant ID: vg0619177386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19177386 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTGAACAATGTTACTATTACTTTGTCGGATGAAGAAATGACCGAAATAAAAGTTTTAGATTTTGATGAGTTATTCATCTTTGTTGTTGATAACTTTTTCA[G/A]
TTGAAATCATTTAGTATTTGAAAATATTGTTTGAAGTTGTCATATTTTTAAATTTAAATTCGAACAGTTCAAAAAATGTTATATAGAAAAATGGCCAAAA
TTTTGGCCATTTTTCTATATAACATTTTTTGAACTGTTCGAATTTAAATTTAAAAATATGACAACTTCAAACAATATTTTCAAATACTAAATGATTTCAA[C/T]
TGAAAAAGTTATCAACAACAAAGATGAATAACTCATCAAAATCTAAAACTTTTATTTCGGTCATTTCTTCATCCGACAAAGTAATAGTAACATTGTTCAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 6.10% | 0.95% | 5.50% | NA |
| All Indica | 2759 | 98.60% | 0.80% | 0.18% | 0.36% | NA |
| All Japonica | 1512 | 64.00% | 17.20% | 2.58% | 16.27% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.00% | 0.17% | 1.51% | NA |
| Indica II | 465 | 98.30% | 1.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.70% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 73.00% | 0.40% | 2.74% | 23.86% | NA |
| Tropical Japonica | 504 | 45.80% | 48.20% | 2.78% | 3.17% | NA |
| Japonica Intermediate | 241 | 73.00% | 5.80% | 1.66% | 19.50% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 91.10% | 4.40% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619177386 | G -> A | LOC_Os06g32920-LOC_Os06g32944 | intergenic_region ; MODIFIER | silent_mutation | Average:13.821; most accessible tissue: Zhenshan97 young leaf, score: 19.578 | N | N | N | N |
| vg0619177386 | G -> DEL | N | N | silent_mutation | Average:13.821; most accessible tissue: Zhenshan97 young leaf, score: 19.578 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619177386 | NA | 7.29E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | 4.66E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | 3.31E-06 | NA | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | NA | 7.78E-07 | mr1217_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | NA | 7.39E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | NA | 3.47E-09 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | NA | 1.12E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | 1.29E-06 | NA | mr1800_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | 2.48E-06 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619177386 | NA | 1.49E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |