\
| Variant ID: vg0619176470 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19176470 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTTCTATCTGTGACGGCCTCTAACATGCCTAGAAATAGCGGGCCGTCACAAGGAAGTTATCGCAATCAGGCCGAAAAAGTGCCCGATTGAGATATGGTC[A/G]
CACCCATATGTTAGATGGGCATAAAACTTAAGCCCGTCACGGATGACATCTATCAGTGACGGGCCGTAGTTTAGACTCGATTGAGATAACATTCCATATC
GATATGGAATGTTATCTCAATCGAGTCTAAACTACGGCCCGTCACTGATAGATGTCATCCGTGACGGGCTTAAGTTTTATGCCCATCTAACATATGGGTG[T/C]
GACCATATCTCAATCGGGCACTTTTTCGGCCTGATTGCGATAACTTCCTTGTGACGGCCCGCTATTTCTAGGCATGTTAGAGGCCGTCACAGATAGAAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 30.50% | 0.11% | 5.80% | NA |
| All Indica | 2759 | 90.40% | 9.20% | 0.04% | 0.40% | NA |
| All Japonica | 1512 | 6.60% | 76.10% | 0.20% | 17.13% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.00% | 0.00% | 1.51% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.90% | 14.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 12.80% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 3.90% | 70.70% | 0.39% | 25.03% | NA |
| Tropical Japonica | 504 | 11.30% | 85.30% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 5.40% | 73.90% | 0.00% | 20.75% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 65.60% | 31.10% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619176470 | A -> G | LOC_Os06g32920-LOC_Os06g32944 | intergenic_region ; MODIFIER | silent_mutation | Average:58.235; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0619176470 | A -> DEL | N | N | silent_mutation | Average:58.235; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619176470 | 7.36E-07 | NA | mr1033 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 7.50E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 4.30E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 9.26E-09 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 1.87E-10 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 2.66E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 6.19E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 2.97E-08 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 2.13E-06 | mr1269_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 9.28E-12 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 5.75E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 1.09E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 5.27E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619176470 | NA | 8.04E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |