\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619160800:

Variant ID: vg0619160800 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19160800
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCGGAGGAGCGCGGGCAGTGGATCCGGCGGCGAGGAGGAACCCAAGCGGCAGATCCAGTGGTGGGGAGGAGCACGGATGGGCCAGTGGAGCTTGGGCAA[C/T]
GGGGAGTCTCACGGCGGTGAGCAGGCCAGCGGAGTTCCAACGTGGCTTCGGCTACAGGCGGGCAGCAACGGTGAGGCTATTGATAGTCCTTAAGTACCAA

Reverse complement sequence

TTGGTACTTAAGGACTATCAATAGCCTCACCGTTGCTGCCCGCCTGTAGCCGAAGCCACGTTGGAACTCCGCTGGCCTGCTCACCGCCGTGAGACTCCCC[G/A]
TTGCCCAAGCTCCACTGGCCCATCCGTGCTCCTCCCCACCACTGGATCTGCCGCTTGGGTTCCTCCTCGCCGCCGGATCCACTGCCCGCGCTCCTCCGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 42.00% 0.36% 1.27% NA
All Indica  2759 88.60% 11.00% 0.33% 0.04% NA
All Japonica  1512 3.70% 92.30% 0.40% 3.57% NA
Aus  269 42.80% 57.20% 0.00% 0.00% NA
Indica I  595 93.30% 5.90% 0.67% 0.17% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 91.30% 8.30% 0.33% 0.00% NA
Indica Intermediate  786 78.20% 21.50% 0.25% 0.00% NA
Temperate Japonica  767 4.70% 90.90% 0.65% 3.78% NA
Tropical Japonica  504 2.00% 96.60% 0.00% 1.39% NA
Japonica Intermediate  241 4.10% 88.00% 0.41% 7.47% NA
VI/Aromatic  96 5.20% 90.60% 0.00% 4.17% NA
Intermediate  90 45.60% 51.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619160800 C -> T LOC_Os06g32920.1 missense_variant ; p.Thr110Met; MODERATE nonsynonymous_codon ; T110M Average:74.085; most accessible tissue: Zhenshan97 young leaf, score: 89.978 unknown unknown TOLERATED 0.12
vg0619160800 C -> DEL LOC_Os06g32920.1 N frameshift_variant Average:74.085; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619160800 NA 6.22E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 5.47E-08 mr1042_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 8.68E-07 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.96E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.68E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.76E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 3.33E-07 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 2.13E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.45E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 2.42E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 7.59E-08 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.86E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 3.57E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 8.99E-06 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.34E-07 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 8.05E-12 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 3.87E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.09E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.91E-07 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 2.22E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 3.46E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 2.10E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 1.95E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619160800 NA 9.16E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251