\
| Variant ID: vg0619153237 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19153237 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 241. )
GCAATGTTTTTCGTGATTAGTCTCACATTACACATTGATGATAATTGTGATAAATAATTTGACTCCTGGTTTGGAATGGTATATTCCTGGTATGGAGGTT[A/T]
GATTTGTACAACCGGGGTTGGTTGTTCAAATAAGGTTGGGCCTATGTAACACGGGTGTGTTGTATGGTGTTTATCTAATACTGTTTAATTATTCAACTGT
ACAGTTGAATAATTAAACAGTATTAGATAAACACCATACAACACACCCGTGTTACATAGGCCCAACCTTATTTGAACAACCAACCCCGGTTGTACAAATC[T/A]
AACCTCCATACCAGGAATATACCATTCCAAACCAGGAGTCAAATTATTTATCACAATTATCATCAATGTGTAATGTGAGACTAATCACGAAAAACATTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 31.10% | 2.41% | 0.21% | NA |
| All Indica | 2759 | 94.30% | 2.80% | 2.90% | 0.00% | NA |
| All Japonica | 1512 | 7.60% | 89.70% | 1.98% | 0.66% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 1.70% | 4.54% | 0.00% | NA |
| Indica II | 465 | 95.10% | 3.90% | 1.08% | 0.00% | NA |
| Indica III | 913 | 97.80% | 0.90% | 1.31% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 5.30% | 4.58% | 0.00% | NA |
| Temperate Japonica | 767 | 5.00% | 92.30% | 1.43% | 1.30% | NA |
| Tropical Japonica | 504 | 12.10% | 86.70% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.60% | 88.00% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 32.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619153237 | A -> T | LOC_Os06g32900.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:49.351; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| vg0619153237 | A -> T | LOC_Os06g32910.1 | downstream_gene_variant ; 4001.0bp to feature; MODIFIER | silent_mutation | Average:49.351; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| vg0619153237 | A -> DEL | N | N | silent_mutation | Average:49.351; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619153237 | 2.37E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | 4.23E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 9.20E-10 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | 9.63E-06 | NA | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 4.22E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | 8.15E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 4.40E-21 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 3.71E-16 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 1.18E-06 | mr1900 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 3.07E-21 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 3.50E-10 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 2.05E-06 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 2.26E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619153237 | NA | 5.38E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |