\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619135527:

Variant ID: vg0619135527 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19135527
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGAAAAGTCCTCTCATTCTCGGCCCAGTCTCCTCTCAGCCTACAGTCCTTTCCCTCTCTTTCCCAAAGTCTGCTTTTTGTCCCTCCTTTAATCAGTC[T/C,G]
TTGGAAGTAGAAGCCCAGCAGAAAGTCTAATTTGCGTCCCCTTGTACTGTTCATCTTCAAGCTTGGACAGAAGCCCGAGCTGCCGTCCTGTACCTGTGCA

Reverse complement sequence

TGCACAGGTACAGGACGGCAGCTCGGGCTTCTGTCCAAGCTTGAAGATGAACAGTACAAGGGGACGCAAATTAGACTTTCTGCTGGGCTTCTACTTCCAA[A/G,C]
GACTGATTAAAGGAGGGACAAAAAGCAGACTTTGGGAAAGAGAGGGAAAGGACTGTAGGCTGAGAGGAGACTGGGCCGAGAATGAGAGGACTTTTCCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 37.40% 13.14% 1.12% NA
All Indica  2759 15.60% 61.60% 20.95% 1.85% NA
All Japonica  1512 98.00% 1.00% 0.99% 0.00% NA
Aus  269 85.50% 10.00% 4.46% 0.00% NA
Indica I  595 14.10% 66.60% 18.66% 0.67% NA
Indica II  465 8.60% 64.90% 23.44% 3.01% NA
Indica III  913 13.40% 66.20% 18.95% 1.53% NA
Indica Intermediate  786 23.40% 50.60% 23.54% 2.42% NA
Temperate Japonica  767 97.30% 1.20% 1.56% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.83% 0.00% NA
VI/Aromatic  96 87.50% 8.30% 4.17% 0.00% NA
Intermediate  90 66.70% 17.80% 13.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619135527 T -> C LOC_Os06g32890.1 downstream_gene_variant ; 2802.0bp to feature; MODIFIER silent_mutation Average:70.894; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619135527 T -> C LOC_Os06g32880-LOC_Os06g32890 intergenic_region ; MODIFIER silent_mutation Average:70.894; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619135527 T -> G LOC_Os06g32890.1 downstream_gene_variant ; 2802.0bp to feature; MODIFIER N Average:70.894; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619135527 T -> G LOC_Os06g32880-LOC_Os06g32890 intergenic_region ; MODIFIER N Average:70.894; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0619135527 T -> DEL N N silent_mutation Average:70.894; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0619135527 T C 0.06 0.06 0.03 0.05 0.02 0.01
vg0619135527 T G 0.04 0.04 0.04 0.05 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619135527 NA 6.82E-44 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 5.91E-50 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 3.35E-58 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 8.53E-06 5.50E-53 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 4.71E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 5.94E-50 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 5.01E-28 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 8.95E-42 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 4.54E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 1.06E-62 mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 1.88E-58 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 3.43E-63 mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 2.07E-62 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 4.89E-06 3.92E-70 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 1.53E-07 2.41E-62 mr1090_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 3.54E-06 1.15E-57 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619135527 NA 2.71E-57 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251