\
| Variant ID: vg0619103677 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19103677 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.07, others allele: 0.00, population size: 200. )
GCCATATTTTTTCAGCTTGTTGTCAATCCATGCAAATTGAGCAGTCTTGAAGTTTGATATGAGAATTGTCTTGGATTAATTGAGAAATGTTGAGTGGTAA[A/G]
CATTAGTCAATGCCTAGCAAACATTTGAAGTGTGTAACAAGCGTAAACATGAATCGGATTGTGTATAAGGTAGACAATAATGATAATGTGTGCGGCAAGA
TCTTGCCGCACACATTATCATTATTGTCTACCTTATACACAATCCGATTCATGTTTACGCTTGTTACACACTTCAAATGTTTGCTAGGCATTGACTAATG[T/C]
TTACCACTCAACATTTCTCAATTAATCCAAGACAATTCTCATATCAAACTTCAAGACTGCTCAATTTGCATGGATTGACAACAAGCTGAAAAAATATGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 43.10% | 0.21% | 1.50% | NA |
| All Indica | 2759 | 81.60% | 17.90% | 0.18% | 0.33% | NA |
| All Japonica | 1512 | 4.40% | 91.70% | 0.33% | 3.64% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.00% | 19.00% | 0.17% | 0.84% | NA |
| Indica II | 465 | 93.30% | 6.20% | 0.22% | 0.22% | NA |
| Indica III | 913 | 81.90% | 17.90% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 75.40% | 24.00% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 4.70% | 91.10% | 0.52% | 3.65% | NA |
| Tropical Japonica | 504 | 4.60% | 94.20% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 2.90% | 88.00% | 0.41% | 8.71% | NA |
| VI/Aromatic | 96 | 3.10% | 92.70% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 50.00% | 46.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619103677 | A -> G | LOC_Os06g32860.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.934; most accessible tissue: Callus, score: 69.448 | N | N | N | N |
| vg0619103677 | A -> G | LOC_Os06g32860.2 | intron_variant ; MODIFIER | silent_mutation | Average:40.934; most accessible tissue: Callus, score: 69.448 | N | N | N | N |
| vg0619103677 | A -> DEL | N | N | silent_mutation | Average:40.934; most accessible tissue: Callus, score: 69.448 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619103677 | NA | 7.01E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 1.85E-07 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 4.54E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | 2.18E-06 | NA | mr1182_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 4.85E-06 | mr1269_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | 1.34E-06 | 3.95E-06 | mr1282_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 4.60E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 3.06E-06 | mr1479_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 3.42E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 1.32E-07 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619103677 | NA | 3.26E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |