\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619103677:

Variant ID: vg0619103677 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19103677
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.07, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GCCATATTTTTTCAGCTTGTTGTCAATCCATGCAAATTGAGCAGTCTTGAAGTTTGATATGAGAATTGTCTTGGATTAATTGAGAAATGTTGAGTGGTAA[A/G]
CATTAGTCAATGCCTAGCAAACATTTGAAGTGTGTAACAAGCGTAAACATGAATCGGATTGTGTATAAGGTAGACAATAATGATAATGTGTGCGGCAAGA

Reverse complement sequence

TCTTGCCGCACACATTATCATTATTGTCTACCTTATACACAATCCGATTCATGTTTACGCTTGTTACACACTTCAAATGTTTGCTAGGCATTGACTAATG[T/C]
TTACCACTCAACATTTCTCAATTAATCCAAGACAATTCTCATATCAAACTTCAAGACTGCTCAATTTGCATGGATTGACAACAAGCTGAAAAAATATGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 43.10% 0.21% 1.50% NA
All Indica  2759 81.60% 17.90% 0.18% 0.33% NA
All Japonica  1512 4.40% 91.70% 0.33% 3.64% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 80.00% 19.00% 0.17% 0.84% NA
Indica II  465 93.30% 6.20% 0.22% 0.22% NA
Indica III  913 81.90% 17.90% 0.11% 0.11% NA
Indica Intermediate  786 75.40% 24.00% 0.25% 0.25% NA
Temperate Japonica  767 4.70% 91.10% 0.52% 3.65% NA
Tropical Japonica  504 4.60% 94.20% 0.00% 1.19% NA
Japonica Intermediate  241 2.90% 88.00% 0.41% 8.71% NA
VI/Aromatic  96 3.10% 92.70% 0.00% 4.17% NA
Intermediate  90 50.00% 46.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619103677 A -> G LOC_Os06g32860.1 intron_variant ; MODIFIER silent_mutation Average:40.934; most accessible tissue: Callus, score: 69.448 N N N N
vg0619103677 A -> G LOC_Os06g32860.2 intron_variant ; MODIFIER silent_mutation Average:40.934; most accessible tissue: Callus, score: 69.448 N N N N
vg0619103677 A -> DEL N N silent_mutation Average:40.934; most accessible tissue: Callus, score: 69.448 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619103677 NA 7.01E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 1.85E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 4.54E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 2.18E-06 NA mr1182_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 4.85E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 1.34E-06 3.95E-06 mr1282_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 4.60E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 3.06E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 3.42E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 1.32E-07 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619103677 NA 3.26E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251