Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619100973:

Variant ID: vg0619100973 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19100973
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTACTACTACTAGGATTGATAATACATGTCGTTTTAAAATGATTCATAATCATTATTTTAAAAATAATTTATAATCTAAAATTTTAAACTTTGACCACA[C/T]
CTTTATCTATAATGATAGTTATTTTCATGTGTAGGTGGACCAGCCGGCCAGCCCTAAGGCCATTCCCAACCCAATGATTAGGATAGTGTCCATAGCATTA

Reverse complement sequence

TAATGCTATGGACACTATCCTAATCATTGGGTTGGGAATGGCCTTAGGGCTGGCCGGCTGGTCCACCTACACATGAAAATAACTATCATTATAGATAAAG[G/A]
TGTGGTCAAAGTTTAAAATTTTAGATTATAAATTATTTTTAAAATAATGATTATGAATCATTTTAAAACGACATGTATTATCAATCCTAGTAGTAGTAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	37.30%	0.21%	1.38%	NA
All Indica	2759	90.80%	9.00%	0.18%	0.07%	NA
All Japonica	1512	4.90%	91.00%	0.33%	3.77%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	93.10%	6.10%	0.67%	0.17%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	94.40%	5.50%	0.11%	0.00%	NA
Indica Intermediate	786	82.60%	17.30%	0.00%	0.13%	NA
Temperate Japonica	767	4.80%	90.70%	0.39%	4.04%	NA
Tropical Japonica	504	5.60%	93.10%	0.20%	1.19%	NA
Japonica Intermediate	241	3.70%	87.60%	0.41%	8.30%	NA
VI/Aromatic	96	5.20%	90.60%	0.00%	4.17%	NA
Intermediate	90	51.10%	46.70%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619100973	C -> T	LOC_Os06g32860.1	upstream_gene_variant ; 585.0bp to feature; MODIFIER	silent_mutation	Average:43.093; most accessible tissue: Callus, score: 69.104	N	N	N	N
vg0619100973	C -> T	LOC_Os06g32860.2	upstream_gene_variant ; 455.0bp to feature; MODIFIER	silent_mutation	Average:43.093; most accessible tissue: Callus, score: 69.104	N	N	N	N
vg0619100973	C -> T	LOC_Os06g32840.1	downstream_gene_variant ; 4364.0bp to feature; MODIFIER	silent_mutation	Average:43.093; most accessible tissue: Callus, score: 69.104	N	N	N	N
vg0619100973	C -> T	LOC_Os06g32850.1	downstream_gene_variant ; 2926.0bp to feature; MODIFIER	silent_mutation	Average:43.093; most accessible tissue: Callus, score: 69.104	N	N	N	N
vg0619100973	C -> T	LOC_Os06g32850-LOC_Os06g32860	intergenic_region ; MODIFIER	silent_mutation	Average:43.093; most accessible tissue: Callus, score: 69.104	N	N	N	N
vg0619100973	C -> DEL	N	N	silent_mutation	Average:43.093; most accessible tissue: Callus, score: 69.104	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619100973	NA	2.12E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	1.03E-07	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	9.16E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	3.37E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	2.46E-08	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	3.63E-06	mr1185_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	5.31E-08	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	4.82E-06	NA	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	2.34E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	3.65E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	9.41E-06	4.18E-08	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	6.70E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	2.18E-08	mr1624_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	8.29E-06	NA	mr1667_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	9.10E-07	mr1677_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	5.00E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	8.01E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	3.42E-08	mr1726_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	8.82E-07	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	5.80E-06	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	2.69E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973	NA	7.85E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251