\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619100973:

Variant ID: vg0619100973 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19100973
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTACTACTACTAGGATTGATAATACATGTCGTTTTAAAATGATTCATAATCATTATTTTAAAAATAATTTATAATCTAAAATTTTAAACTTTGACCACA[C/T]
CTTTATCTATAATGATAGTTATTTTCATGTGTAGGTGGACCAGCCGGCCAGCCCTAAGGCCATTCCCAACCCAATGATTAGGATAGTGTCCATAGCATTA

Reverse complement sequence

TAATGCTATGGACACTATCCTAATCATTGGGTTGGGAATGGCCTTAGGGCTGGCCGGCTGGTCCACCTACACATGAAAATAACTATCATTATAGATAAAG[G/A]
TGTGGTCAAAGTTTAAAATTTTAGATTATAAATTATTTTTAAAATAATGATTATGAATCATTTTAAAACGACATGTATTATCAATCCTAGTAGTAGTAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 37.30% 0.21% 1.38% NA
All Indica  2759 90.80% 9.00% 0.18% 0.07% NA
All Japonica  1512 4.90% 91.00% 0.33% 3.77% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 93.10% 6.10% 0.67% 0.17% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 94.40% 5.50% 0.11% 0.00% NA
Indica Intermediate  786 82.60% 17.30% 0.00% 0.13% NA
Temperate Japonica  767 4.80% 90.70% 0.39% 4.04% NA
Tropical Japonica  504 5.60% 93.10% 0.20% 1.19% NA
Japonica Intermediate  241 3.70% 87.60% 0.41% 8.30% NA
VI/Aromatic  96 5.20% 90.60% 0.00% 4.17% NA
Intermediate  90 51.10% 46.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619100973 C -> T LOC_Os06g32860.1 upstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:43.093; most accessible tissue: Callus, score: 69.104 N N N N
vg0619100973 C -> T LOC_Os06g32860.2 upstream_gene_variant ; 455.0bp to feature; MODIFIER silent_mutation Average:43.093; most accessible tissue: Callus, score: 69.104 N N N N
vg0619100973 C -> T LOC_Os06g32840.1 downstream_gene_variant ; 4364.0bp to feature; MODIFIER silent_mutation Average:43.093; most accessible tissue: Callus, score: 69.104 N N N N
vg0619100973 C -> T LOC_Os06g32850.1 downstream_gene_variant ; 2926.0bp to feature; MODIFIER silent_mutation Average:43.093; most accessible tissue: Callus, score: 69.104 N N N N
vg0619100973 C -> T LOC_Os06g32850-LOC_Os06g32860 intergenic_region ; MODIFIER silent_mutation Average:43.093; most accessible tissue: Callus, score: 69.104 N N N N
vg0619100973 C -> DEL N N silent_mutation Average:43.093; most accessible tissue: Callus, score: 69.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619100973 NA 2.12E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 1.03E-07 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 9.16E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 3.37E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 2.46E-08 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 3.63E-06 mr1185_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 5.31E-08 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 4.82E-06 NA mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 2.34E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 3.65E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 9.41E-06 4.18E-08 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 6.70E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 2.18E-08 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 8.29E-06 NA mr1667_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 9.10E-07 mr1677_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 5.00E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 8.01E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 3.42E-08 mr1726_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 8.82E-07 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 5.80E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 2.69E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619100973 NA 7.85E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251