\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619014811:

Variant ID: vg0619014811 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19014811
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTCAACCTAAGGGACCACGGTGGACCGGGTACACAGAGACGGTCCGCGGGTCGACGAAAGCGGACCCCGTGTATCAACTGAGGCGAGTAGCCGACAAA[C/T]
GGACTCCACCAGACACCACGCGGGCTGCACACGTGGAAACCACGTGGCTACCGAGCGGGCACACTAACACGGTCTCCACACGCACAAGCGAACGACTACC

Reverse complement sequence

GGTAGTCGTTCGCTTGTGCGTGTGGAGACCGTGTTAGTGTGCCCGCTCGGTAGCCACGTGGTTTCCACGTGTGCAGCCCGCGTGGTGTCTGGTGGAGTCC[G/A]
TTTGTCGGCTACTCGCCTCAGTTGATACACGGGGTCCGCTTTCGTCGACCCGCGGACCGTCTCTGTGTACCCGGTCCACCGTGGTCCCTTAGGTTGACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.70% 0.02% 0.11% NA
All Indica  2759 91.20% 8.70% 0.04% 0.00% NA
All Japonica  1512 99.20% 0.50% 0.00% 0.33% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 87.70% 12.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 87.50% 12.40% 0.11% 0.00% NA
Indica Intermediate  786 93.50% 6.50% 0.00% 0.00% NA
Temperate Japonica  767 99.20% 0.10% 0.00% 0.65% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619014811 C -> T LOC_Os06g32700.1 upstream_gene_variant ; 471.0bp to feature; MODIFIER silent_mutation Average:76.435; most accessible tissue: Minghui63 flag leaf, score: 95.052 N N N N
vg0619014811 C -> T LOC_Os06g32690.1 downstream_gene_variant ; 3281.0bp to feature; MODIFIER silent_mutation Average:76.435; most accessible tissue: Minghui63 flag leaf, score: 95.052 N N N N
vg0619014811 C -> T LOC_Os06g32710.1 downstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:76.435; most accessible tissue: Minghui63 flag leaf, score: 95.052 N N N N
vg0619014811 C -> T LOC_Os06g32690-LOC_Os06g32700 intergenic_region ; MODIFIER silent_mutation Average:76.435; most accessible tissue: Minghui63 flag leaf, score: 95.052 N N N N
vg0619014811 C -> DEL N N silent_mutation Average:76.435; most accessible tissue: Minghui63 flag leaf, score: 95.052 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0619014811 C T -0.01 -0.01 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619014811 NA 5.19E-07 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 7.26E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 8.61E-06 mr1223_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 6.15E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 9.16E-08 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 3.09E-07 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 1.38E-07 mr1543_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 1.40E-06 mr1677_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 1.93E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 NA 8.05E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619014811 9.73E-06 9.72E-06 mr1912_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251