Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619002190:

Variant ID: vg0619002190 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19002190
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCAGGGTCATAGGGAGGCAGAAATTTAGTATTATGCAAGATGACATCAAGCTCGTGCCGGCCGCAGAGAAGGACATTGCTTGGCTAACGTTCAAGGAT[C/T]
TATTCGACCTCTACAGTCTCCGAGCGGTGGACACAAGCCTCCTTAAGTGCTACTCCTTGTAAGTATTGTCGCCCAACTCAATCTGGTAATAACAATCGGA

Reverse complement sequence

TCCGATTGTTATTACCAGATTGAGTTGGGCGACAATACTTACAAGGAGTAGCACTTAAGGAGGCTTGTGTCCACCGCTCGGAGACTGTAGAGGTCGAATA[G/A]
ATCCTTGAACGTTAGCCAAGCAATGTCCTTCTCTGCGGCCGGCACGAGCTTGATGTCATCTTGCATAATACTAAATTTCTGCCTCCCTATGACCCTGCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	6.20%	0.11%	1.82%	NA
All Indica	2759	95.80%	4.00%	0.11%	0.04%	NA
All Japonica	1512	93.10%	1.70%	0.00%	5.29%	NA
Aus	269	44.60%	55.40%	0.00%	0.00%	NA
Indica I	595	99.30%	0.20%	0.50%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	94.10%	5.90%	0.00%	0.00%	NA
Indica Intermediate	786	92.70%	7.10%	0.00%	0.13%	NA
Temperate Japonica	767	93.60%	0.10%	0.00%	6.26%	NA
Tropical Japonica	504	93.30%	4.80%	0.00%	1.98%	NA
Japonica Intermediate	241	90.90%	0.00%	0.00%	9.13%	NA
VI/Aromatic	96	93.80%	2.10%	1.04%	3.12%	NA
Intermediate	90	92.20%	4.40%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619002190	C -> T	LOC_Os06g32674.1	synonymous_variant ; p.Leu90Leu; LOW	synonymous_codon	Average:43.294; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0619002190	C -> DEL	LOC_Os06g32674.1	N	frameshift_variant	Average:43.294; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619002190	NA	2.71E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	8.71E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	3.13E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	8.32E-07	mr1311	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	1.74E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	6.53E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	1.13E-06	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	2.91E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	9.57E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	4.63E-06	mr1433	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	1.39E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	3.59E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	2.98E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	4.10E-07	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	4.02E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	3.26E-06	3.25E-06	mr1688	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	7.80E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	9.48E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190	NA	2.94E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251