\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619002190:

Variant ID: vg0619002190 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19002190
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCAGGGTCATAGGGAGGCAGAAATTTAGTATTATGCAAGATGACATCAAGCTCGTGCCGGCCGCAGAGAAGGACATTGCTTGGCTAACGTTCAAGGAT[C/T]
TATTCGACCTCTACAGTCTCCGAGCGGTGGACACAAGCCTCCTTAAGTGCTACTCCTTGTAAGTATTGTCGCCCAACTCAATCTGGTAATAACAATCGGA

Reverse complement sequence

TCCGATTGTTATTACCAGATTGAGTTGGGCGACAATACTTACAAGGAGTAGCACTTAAGGAGGCTTGTGTCCACCGCTCGGAGACTGTAGAGGTCGAATA[G/A]
ATCCTTGAACGTTAGCCAAGCAATGTCCTTCTCTGCGGCCGGCACGAGCTTGATGTCATCTTGCATAATACTAAATTTCTGCCTCCCTATGACCCTGCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 6.20% 0.11% 1.82% NA
All Indica  2759 95.80% 4.00% 0.11% 0.04% NA
All Japonica  1512 93.10% 1.70% 0.00% 5.29% NA
Aus  269 44.60% 55.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 94.10% 5.90% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.10% 0.00% 0.13% NA
Temperate Japonica  767 93.60% 0.10% 0.00% 6.26% NA
Tropical Japonica  504 93.30% 4.80% 0.00% 1.98% NA
Japonica Intermediate  241 90.90% 0.00% 0.00% 9.13% NA
VI/Aromatic  96 93.80% 2.10% 1.04% 3.12% NA
Intermediate  90 92.20% 4.40% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619002190 C -> T LOC_Os06g32674.1 synonymous_variant ; p.Leu90Leu; LOW synonymous_codon Average:43.294; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0619002190 C -> DEL LOC_Os06g32674.1 N frameshift_variant Average:43.294; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619002190 NA 2.71E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 8.71E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 3.13E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 8.32E-07 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 1.74E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 6.53E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 1.13E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 2.91E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 9.57E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 4.63E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 1.39E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 3.59E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 2.98E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 4.10E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 4.02E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 3.26E-06 3.25E-06 mr1688 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 7.80E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 9.48E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619002190 NA 2.94E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251