Search for Variation information by Variation ID:
Detailed information for vg0618995969:
| Variant ID: vg0618995969 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18995969 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 281. )
Flanking Sequence (100 bp) in Reference Genome:
GAAGATGAGCATGACATGTTTATACCTTCTCCATTGGGCGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATGTTATGTGACATTAAGGACC[C/T]
AGCCCAGAATGAGAGAGATGGAATGAAGTTCAGCAGGTTGGTCAGTGATTCCGAGACGCCTCTGTACGCTGGATGCAAAGCAAAACACACTAAGTTGTCA
Reverse complement sequence
TGACAACTTAGTGTGTTTTGCTTTGCATCCAGCGTACAGAGGCGTCTCGGAATCACTGACCAACCTGCTGAACTTCATTCCATCTCTCTCATTCTGGGCT[G/A]
GGTCCTTAATGTCACATAACATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCGCCCAATGGAGAAGGTATAAACATGTCATGCTCATCTTC
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 47.20% | 0.15% | 2.01% | NA |
| All Indica | 2759 | 79.90% | 19.70% | 0.18% | 0.22% | NA |
| All Japonica | 1512 | 2.70% | 91.70% | 0.07% | 5.49% | NA |
| Aus | 269 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.30% | 19.30% | 0.50% | 0.84% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.00% | 21.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 74.60% | 25.20% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 3.90% | 89.40% | 0.00% | 6.65% | NA |
| Tropical Japonica | 504 | 0.80% | 97.20% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 2.90% | 87.60% | 0.41% | 9.13% | NA |
| VI/Aromatic | 96 | 3.10% | 92.70% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 46.70% | 50.00% | 1.11% | 2.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618995969 | C -> T | LOC_Os06g32660.1 | missense_variant ; p.Pro65Leu; MODERATE | nonsynonymous_codon ; P65L | Average:31.756; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | probably damaging  |
2.029 |
TOLERATED | 0.23 |
| vg0618995969 | C -> DEL | LOC_Os06g32660.1 | N | frameshift_variant | Average:31.756; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618995969 | 7.14E-06 | 1.22E-07 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | 8.83E-06 | 4.08E-07 | mr1185_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | NA | 3.95E-07 | mr1269_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | NA | 5.67E-06 | mr1291_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | NA | 1.17E-13 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | 8.31E-06 | 8.30E-06 | mr1477_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | 6.29E-06 | 1.97E-07 | mr1479_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | 3.81E-06 | 2.21E-07 | mr1677_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | NA | 1.52E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | NA | 3.22E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618995969 | NA | 5.99E-06 | mr1912_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |