| Variant ID: vg0618987742 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18987742 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTCAAACATTTTGAAATGGAGGGAGTACTACTTTATGAATGAGTACTCGAAGAATTGATACGTTATATGATCAGATCAGCCACAACATAAGTGAACAAAT[A/T]
CAGCAAACATTTGTAATATTTCATTATCTAAGATATTGAAGAAACTGTTTTGTATATATGCTGCAGAGTCGAAGGTTGTGACAAATTCTCCAAGTGGTCA
TGACCACTTGGAGAATTTGTCACAACCTTCGACTCTGCAGCATATATACAAAACAGTTTCTTCAATATCTTAGATAATGAAATATTACAAATGTTTGCTG[T/A]
ATTTGTTCACTTATGTTGTGGCTGATCTGATCATATAACGTATCAATTCTTCGAGTACTCATTCATAAAGTAGTACTCCCTCCATTTCAAAATGTTTGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 6.90% | 0.00% | 1.99% | NA |
| All Indica | 2759 | 95.80% | 4.00% | 0.00% | 0.22% | NA |
| All Japonica | 1512 | 90.90% | 3.70% | 0.00% | 5.36% | NA |
| Aus | 269 | 44.60% | 55.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.20% | 0.00% | 0.84% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.00% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 93.50% | 0.10% | 0.00% | 6.39% | NA |
| Tropical Japonica | 504 | 87.10% | 10.90% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 90.90% | 0.00% | 0.00% | 9.13% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618987742 | A -> T | LOC_Os06g32650.1 | downstream_gene_variant ; 1799.0bp to feature; MODIFIER | silent_mutation | Average:51.358; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0618987742 | A -> T | LOC_Os06g32650-LOC_Os06g32660 | intergenic_region ; MODIFIER | silent_mutation | Average:51.358; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0618987742 | A -> DEL | N | N | silent_mutation | Average:51.358; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618987742 | 1.08E-09 | NA | mr1033_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |