\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618986068:

Variant ID: vg0618986068 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18986068
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AGACCATTCACCCTAGCACATCTAGCTACTGTTTAGCAAGGTAATCAGGACTACTTACAGCTAGTTTGTTGCTCACAAGAATGTGAGTTCCCTATGCCTC[C/T]
CTTTCCTAATAGGCATCCTGTGCGCAATTACCTTCTAAGTTACCTATAGTAGTCTTCAAGGTGAGAGGTGAGGACCGAATATTTGATCTTCCAGCAATTT

Reverse complement sequence

AAATTGCTGGAAGATCAAATATTCGGTCCTCACCTCTCACCTTGAAGACTACTATAGGTAACTTAGAAGGTAATTGCGCACAGGATGCCTATTAGGAAAG[G/A]
GAGGCATAGGGAACTCACATTCTTGTGAGCAACAAACTAGCTGTAAGTAGTCCTGATTACCTTGCTAAACAGTAGCTAGATGTGCTAGGGTGAATGGTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 33.90% 0.06% 2.12% NA
All Indica  2759 93.90% 5.80% 0.04% 0.22% NA
All Japonica  1512 7.10% 87.00% 0.13% 5.75% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.40% 5.50% 0.17% 0.84% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 89.40% 10.40% 0.00% 0.13% NA
Temperate Japonica  767 4.40% 88.40% 0.13% 7.04% NA
Tropical Japonica  504 12.70% 85.30% 0.00% 1.98% NA
Japonica Intermediate  241 3.70% 86.30% 0.41% 9.54% NA
VI/Aromatic  96 6.20% 89.60% 0.00% 4.17% NA
Intermediate  90 54.40% 42.20% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618986068 C -> T LOC_Os06g32650.1 downstream_gene_variant ; 125.0bp to feature; MODIFIER silent_mutation Average:95.728; most accessible tissue: Callus, score: 99.301 N N N N
vg0618986068 C -> T LOC_Os06g32650-LOC_Os06g32660 intergenic_region ; MODIFIER silent_mutation Average:95.728; most accessible tissue: Callus, score: 99.301 N N N N
vg0618986068 C -> DEL N N silent_mutation Average:95.728; most accessible tissue: Callus, score: 99.301 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0618986068 C T -0.02 -0.02 -0.01 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618986068 NA 1.38E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 3.03E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 2.92E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 1.70E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 2.56E-07 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 7.46E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 9.42E-08 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 4.26E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 5.75E-07 5.75E-07 mr1587_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 1.26E-08 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 1.05E-06 2.29E-06 mr1667_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 1.75E-06 mr1677_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 8.05E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 4.74E-06 2.80E-10 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 3.04E-06 3.04E-06 mr1681_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 2.19E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 2.95E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 1.23E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 3.86E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 5.48E-07 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 4.33E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 NA 7.43E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618986068 7.20E-06 7.20E-06 mr1981_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251