\
| Variant ID: vg0618973254 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18973254 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTGCACTGACTAGATGCACCTAATAGGTGTAGCCCCTGACTATGTGCTTAGTTGAACAAACTAAACATATAGTCAAGGAGTAAATAATCCAACCAACCGA[G/A]
TGGTTTTGATAATTGTAGTCAACCAAGTGACTTAATATTAAGATGTAGCATATGCGGTGTGAATCCCCGAGTAATCATGATATACCGACTGCTTTGTAAA
TTTACAAAGCAGTCGGTATATCATGATTACTCGGGGATTCACACCGCATATGCTACATCTTAATATTAAGTCACTTGGTTGACTACAATTATCAAAACCA[C/T]
TCGGTTGGTTGGATTATTTACTCCTTGACTATATGTTTAGTTTGTTCAACTAAGCACATAGTCAGGGGCTACACCTATTAGGTGCATCTAGTCAGTGCAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 0.30% | 2.26% | 5.82% | NA |
| All Indica | 2759 | 99.50% | 0.00% | 0.11% | 0.43% | NA |
| All Japonica | 1512 | 80.80% | 0.40% | 1.46% | 17.39% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.00% | 0.00% | 1.68% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 70.90% | 0.50% | 0.78% | 27.77% | NA |
| Tropical Japonica | 504 | 96.80% | 0.20% | 0.99% | 1.98% | NA |
| Japonica Intermediate | 241 | 78.40% | 0.40% | 4.56% | 16.60% | NA |
| VI/Aromatic | 96 | 15.60% | 8.30% | 76.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618973254 | G -> A | LOC_Os06g32630.1 | downstream_gene_variant ; 2816.0bp to feature; MODIFIER | silent_mutation | Average:44.138; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0618973254 | G -> A | LOC_Os06g32610-LOC_Os06g32630 | intergenic_region ; MODIFIER | silent_mutation | Average:44.138; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0618973254 | G -> DEL | N | N | silent_mutation | Average:44.138; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618973254 | NA | 4.33E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | NA | 2.62E-06 | mr1565 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | NA | 8.46E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | 1.70E-06 | NA | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | 1.70E-06 | 1.70E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | NA | 2.66E-09 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | 1.26E-06 | 1.70E-09 | mr1565_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | NA | 3.92E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618973254 | NA | 1.03E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |