\
| Variant ID: vg0618969958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18969958 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 107. )
TACAGTTCTGGTAGTAAAACACCAGTACAGATGGTCATAAGGCTTGAGGCCCGATAGTTGGGCCGTGCCTGGGCCGATGCCTTGGCACGGTGGGCTGGCC[C/T]
GACACGGCACAATCAAAGAAAAAGTTGAGGAATCCAAAATAGACTTAACTCAGCCATACAAGACATGGCCCATAGAGAAGAAGGATACACGATAGACTTA
TAAGTCTATCGTGTATCCTTCTTCTCTATGGGCCATGTCTTGTATGGCTGAGTTAAGTCTATTTTGGATTCCTCAACTTTTTCTTTGATTGTGCCGTGTC[G/A]
GGCCAGCCCACCGTGCCAAGGCATCGGCCCAGGCACGGCCCAACTATCGGGCCTCAAGCCTTATGACCATCTGTACTGGTGTTTTACTACCAGAACTGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 40.40% | 0.53% | 8.51% | NA |
| All Indica | 2759 | 80.10% | 18.90% | 0.43% | 0.62% | NA |
| All Japonica | 1512 | 2.60% | 77.80% | 0.60% | 18.98% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.70% | 18.20% | 0.34% | 1.85% | NA |
| Indica II | 465 | 93.50% | 6.00% | 0.22% | 0.22% | NA |
| Indica III | 913 | 77.90% | 21.60% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 74.90% | 23.90% | 0.76% | 0.38% | NA |
| Temperate Japonica | 767 | 3.70% | 66.80% | 1.17% | 28.42% | NA |
| Tropical Japonica | 504 | 0.80% | 95.80% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 3.30% | 75.10% | 0.00% | 21.58% | NA |
| VI/Aromatic | 96 | 4.20% | 6.20% | 0.00% | 89.58% | NA |
| Intermediate | 90 | 42.20% | 40.00% | 4.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618969958 | C -> T | LOC_Os06g32610-LOC_Os06g32630 | intergenic_region ; MODIFIER | silent_mutation | Average:73.368; most accessible tissue: Callus, score: 92.059 | N | N | N | N |
| vg0618969958 | C -> DEL | N | N | silent_mutation | Average:73.368; most accessible tissue: Callus, score: 92.059 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618969958 | NA | 6.82E-15 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 8.62E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 4.20E-12 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 4.51E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 1.24E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 3.14E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 4.75E-10 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | 4.28E-06 | 3.76E-07 | mr1677 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 2.46E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 2.26E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 8.83E-08 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 2.13E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 3.45E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 3.93E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 4.81E-11 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 4.21E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 7.73E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618969958 | NA | 4.11E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |