\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618969958:

Variant ID: vg0618969958 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18969958
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TACAGTTCTGGTAGTAAAACACCAGTACAGATGGTCATAAGGCTTGAGGCCCGATAGTTGGGCCGTGCCTGGGCCGATGCCTTGGCACGGTGGGCTGGCC[C/T]
GACACGGCACAATCAAAGAAAAAGTTGAGGAATCCAAAATAGACTTAACTCAGCCATACAAGACATGGCCCATAGAGAAGAAGGATACACGATAGACTTA

Reverse complement sequence

TAAGTCTATCGTGTATCCTTCTTCTCTATGGGCCATGTCTTGTATGGCTGAGTTAAGTCTATTTTGGATTCCTCAACTTTTTCTTTGATTGTGCCGTGTC[G/A]
GGCCAGCCCACCGTGCCAAGGCATCGGCCCAGGCACGGCCCAACTATCGGGCCTCAAGCCTTATGACCATCTGTACTGGTGTTTTACTACCAGAACTGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 40.40% 0.53% 8.51% NA
All Indica  2759 80.10% 18.90% 0.43% 0.62% NA
All Japonica  1512 2.60% 77.80% 0.60% 18.98% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 79.70% 18.20% 0.34% 1.85% NA
Indica II  465 93.50% 6.00% 0.22% 0.22% NA
Indica III  913 77.90% 21.60% 0.33% 0.22% NA
Indica Intermediate  786 74.90% 23.90% 0.76% 0.38% NA
Temperate Japonica  767 3.70% 66.80% 1.17% 28.42% NA
Tropical Japonica  504 0.80% 95.80% 0.00% 3.37% NA
Japonica Intermediate  241 3.30% 75.10% 0.00% 21.58% NA
VI/Aromatic  96 4.20% 6.20% 0.00% 89.58% NA
Intermediate  90 42.20% 40.00% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618969958 C -> T LOC_Os06g32610-LOC_Os06g32630 intergenic_region ; MODIFIER silent_mutation Average:73.368; most accessible tissue: Callus, score: 92.059 N N N N
vg0618969958 C -> DEL N N silent_mutation Average:73.368; most accessible tissue: Callus, score: 92.059 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618969958 NA 6.82E-15 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 8.62E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 4.20E-12 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 4.51E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 1.24E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 3.14E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 4.75E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 4.28E-06 3.76E-07 mr1677 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 2.46E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 2.26E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 8.83E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 2.13E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 3.45E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 3.93E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 4.81E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 4.21E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 7.73E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618969958 NA 4.11E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251