\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618965393:

Variant ID: vg0618965393 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18965393
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTACTACTACTAAACCATTTGTATAGTTCTCAGACATTTTAGACTGTGTTTAGTTCCATATTAAAATTAGAAATTTGAAAAAAATGAAACGAAGTGACG[G/A]
AAAAGTTGAAAGTTTATGTGTGTAGAAAAGTTCGATGTGACAGAAAAGTTGAAAATTTGAAGAAAAAAATTGGAATCTAAACATGATCTTAATTATTATA

Reverse complement sequence

TATAATAATTAAGATCATGTTTAGATTCCAATTTTTTTCTTCAAATTTTCAACTTTTCTGTCACATCGAACTTTTCTACACACATAAACTTTCAACTTTT[C/T]
CGTCACTTCGTTTCATTTTTTTCAAATTTCTAATTTTAATATGGAACTAAACACAGTCTAAAATGTCTGAGAACTATACAAATGGTTTAGTAGTAGTACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 38.20% 0.36% 6.75% NA
All Indica  2759 83.50% 15.50% 0.47% 0.51% NA
All Japonica  1512 3.00% 77.20% 0.20% 19.64% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 83.70% 13.30% 1.18% 1.85% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 79.60% 20.40% 0.00% 0.00% NA
Indica Intermediate  786 81.20% 17.80% 0.64% 0.38% NA
Temperate Japonica  767 3.80% 65.80% 0.26% 30.12% NA
Tropical Japonica  504 0.80% 95.80% 0.00% 3.37% NA
Japonica Intermediate  241 5.00% 74.30% 0.41% 20.33% NA
VI/Aromatic  96 91.70% 4.20% 0.00% 4.17% NA
Intermediate  90 54.40% 40.00% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618965393 G -> A LOC_Os06g32610-LOC_Os06g32630 intergenic_region ; MODIFIER silent_mutation Average:59.218; most accessible tissue: Zhenshan97 flower, score: 83.605 N N N N
vg0618965393 G -> DEL N N silent_mutation Average:59.218; most accessible tissue: Zhenshan97 flower, score: 83.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618965393 NA 1.40E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0618965393 NA 5.63E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 2.09E-16 mr1138 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 3.13E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 6.06E-10 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 1.22E-12 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 8.32E-07 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 1.29E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 1.53E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 1.19E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 5.21E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 5.97E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 6.56E-07 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 4.92E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 7.85E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 1.10E-13 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 6.26E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 1.75E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 7.43E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 8.00E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 5.51E-07 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 1.10E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618965393 NA 7.06E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251