\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618947595:

Variant ID: vg0618947595 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18947595
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCACGCAAAACGAGGAAAAACTCTAATAAAAACCAATGAAAAAGTACATAAAAAGTAAACAAACATGTAGAGCTCAATTTTAGATGAATTTTGCAAGTT[G/C]
AACGGCTCAATTCGGAGTTCAAATGAATTAGATATGAATTTTAGAAGTTTTGAGCCATTTAAATGAATTTCTAGAATTATTAACGAATTATTGCGCAATT

Reverse complement sequence

AATTGCGCAATAATTCGTTAATAATTCTAGAAATTCATTTAAATGGCTCAAAACTTCTAAAATTCATATCTAATTCATTTGAACTCCGAATTGAGCCGTT[C/G]
AACTTGCAAAATTCATCTAAAATTGAGCTCTACATGTTTGTTTACTTTTTATGTACTTTTTCATTGGTTTTTATTAGAGTTTTTCCTCGTTTTGCGTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 5.80% 0.06% 6.75% NA
All Indica  2759 90.60% 8.80% 0.00% 0.51% NA
All Japonica  1512 79.60% 0.50% 0.20% 19.71% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 86.10% 12.10% 0.00% 1.85% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 87.30% 12.70% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 6.60% 0.00% 0.38% NA
Temperate Japonica  767 69.20% 0.10% 0.26% 30.38% NA
Tropical Japonica  504 95.80% 1.00% 0.00% 3.17% NA
Japonica Intermediate  241 78.80% 0.40% 0.41% 20.33% NA
VI/Aromatic  96 93.80% 2.10% 0.00% 4.17% NA
Intermediate  90 95.60% 1.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618947595 G -> C LOC_Os06g32580.1 downstream_gene_variant ; 3779.0bp to feature; MODIFIER silent_mutation Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0618947595 G -> C LOC_Os06g32570-LOC_Os06g32580 intergenic_region ; MODIFIER silent_mutation Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0618947595 G -> DEL N N silent_mutation Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618947595 NA 2.44E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 7.20E-07 NA mr1093_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 NA 3.25E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 NA 1.20E-06 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 NA 6.83E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 NA 3.31E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 5.80E-06 1.55E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 3.60E-06 3.60E-06 mr1730_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595 2.61E-06 7.11E-07 mr1860_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251