Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618947595:

Variant ID: vg0618947595 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18947595
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCACGCAAAACGAGGAAAAACTCTAATAAAAACCAATGAAAAAGTACATAAAAAGTAAACAAACATGTAGAGCTCAATTTTAGATGAATTTTGCAAGTT[G/C]
AACGGCTCAATTCGGAGTTCAAATGAATTAGATATGAATTTTAGAAGTTTTGAGCCATTTAAATGAATTTCTAGAATTATTAACGAATTATTGCGCAATT

Reverse complement sequence

AATTGCGCAATAATTCGTTAATAATTCTAGAAATTCATTTAAATGGCTCAAAACTTCTAAAATTCATATCTAATTCATTTGAACTCCGAATTGAGCCGTT[C/G]
AACTTGCAAAATTCATCTAAAATTGAGCTCTACATGTTTGTTTACTTTTTATGTACTTTTTCATTGGTTTTTATTAGAGTTTTTCCTCGTTTTGCGTGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.40%	5.80%	0.06%	6.75%	NA
All Indica	2759	90.60%	8.80%	0.00%	0.51%	NA
All Japonica	1512	79.60%	0.50%	0.20%	19.71%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	86.10%	12.10%	0.00%	1.85%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	87.30%	12.70%	0.00%	0.00%	NA
Indica Intermediate	786	93.00%	6.60%	0.00%	0.38%	NA
Temperate Japonica	767	69.20%	0.10%	0.26%	30.38%	NA
Tropical Japonica	504	95.80%	1.00%	0.00%	3.17%	NA
Japonica Intermediate	241	78.80%	0.40%	0.41%	20.33%	NA
VI/Aromatic	96	93.80%	2.10%	0.00%	4.17%	NA
Intermediate	90	95.60%	1.10%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618947595	G -> C	LOC_Os06g32580.1	downstream_gene_variant ; 3779.0bp to feature; MODIFIER	silent_mutation	Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0618947595	G -> C	LOC_Os06g32570-LOC_Os06g32580	intergenic_region ; MODIFIER	silent_mutation	Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0618947595	G -> DEL	N	N	silent_mutation	Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618947595	NA	2.44E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	7.20E-07	NA	mr1093_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	NA	3.25E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	NA	1.20E-06	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	NA	6.83E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	NA	3.31E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	5.80E-06	1.55E-06	mr1551_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	3.60E-06	3.60E-06	mr1730_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618947595	2.61E-06	7.11E-07	mr1860_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251