\
| Variant ID: vg0618947595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18947595 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGCACGCAAAACGAGGAAAAACTCTAATAAAAACCAATGAAAAAGTACATAAAAAGTAAACAAACATGTAGAGCTCAATTTTAGATGAATTTTGCAAGTT[G/C]
AACGGCTCAATTCGGAGTTCAAATGAATTAGATATGAATTTTAGAAGTTTTGAGCCATTTAAATGAATTTCTAGAATTATTAACGAATTATTGCGCAATT
AATTGCGCAATAATTCGTTAATAATTCTAGAAATTCATTTAAATGGCTCAAAACTTCTAAAATTCATATCTAATTCATTTGAACTCCGAATTGAGCCGTT[C/G]
AACTTGCAAAATTCATCTAAAATTGAGCTCTACATGTTTGTTTACTTTTTATGTACTTTTTCATTGGTTTTTATTAGAGTTTTTCCTCGTTTTGCGTGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 5.80% | 0.06% | 6.75% | NA |
| All Indica | 2759 | 90.60% | 8.80% | 0.00% | 0.51% | NA |
| All Japonica | 1512 | 79.60% | 0.50% | 0.20% | 19.71% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.10% | 12.10% | 0.00% | 1.85% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 6.60% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 69.20% | 0.10% | 0.26% | 30.38% | NA |
| Tropical Japonica | 504 | 95.80% | 1.00% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 78.80% | 0.40% | 0.41% | 20.33% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618947595 | G -> C | LOC_Os06g32580.1 | downstream_gene_variant ; 3779.0bp to feature; MODIFIER | silent_mutation | Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0618947595 | G -> C | LOC_Os06g32570-LOC_Os06g32580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0618947595 | G -> DEL | N | N | silent_mutation | Average:42.519; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618947595 | NA | 2.44E-06 | mr1959 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | 7.20E-07 | NA | mr1093_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | NA | 3.25E-06 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | NA | 1.20E-06 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | NA | 6.83E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | NA | 3.31E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | 5.80E-06 | 1.55E-06 | mr1551_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | 3.60E-06 | 3.60E-06 | mr1730_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618947595 | 2.61E-06 | 7.11E-07 | mr1860_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |