\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618930430:

Variant ID: vg0618930430 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18930430
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTCATGTTAAAATGCCTCCCGTTTGGAAGAAAATATTTAACACATTAGTTGTTGCATGAGGGCATAGGATGAAAGGCGCATAAATATACTTATATTT[C/A]
TGGTTTCTTGATGACCAAATGTTAGAAATGATATGTGATGAAACTAGAAACTCGATTATATTTATTTTTTAGCCAAGATATCATCACTCAACATATCCTC

Reverse complement sequence

GAGGATATGTTGAGTGATGATATCTTGGCTAAAAAATAAATATAATCGAGTTTCTAGTTTCATCACATATCATTTCTAACATTTGGTCATCAAGAAACCA[G/T]
AAATATAAGTATATTTATGCGCCTTTCATCCTATGCCCTCATGCAACAACTAATGTGTTAAATATTTTCTTCCAAACGGGAGGCATTTTAACATGAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 5.40% 3.62% 6.73% NA
All Indica  2759 85.50% 8.50% 5.44% 0.51% NA
All Japonica  1512 78.60% 0.90% 1.06% 19.51% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 87.10% 0.00% 11.09% 1.85% NA
Indica II  465 80.20% 11.60% 8.17% 0.00% NA
Indica III  913 85.20% 14.10% 0.66% 0.00% NA
Indica Intermediate  786 87.90% 6.60% 5.09% 0.38% NA
Temperate Japonica  767 67.00% 1.40% 1.56% 29.99% NA
Tropical Japonica  504 96.20% 0.20% 0.20% 3.37% NA
Japonica Intermediate  241 78.40% 0.40% 1.24% 19.92% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 82.20% 8.90% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618930430 C -> A LOC_Os06g32530.1 downstream_gene_variant ; 3081.0bp to feature; MODIFIER silent_mutation Average:33.497; most accessible tissue: Callus, score: 65.449 N N N N
vg0618930430 C -> A LOC_Os06g32550.1 downstream_gene_variant ; 71.0bp to feature; MODIFIER silent_mutation Average:33.497; most accessible tissue: Callus, score: 65.449 N N N N
vg0618930430 C -> A LOC_Os06g32530-LOC_Os06g32550 intergenic_region ; MODIFIER silent_mutation Average:33.497; most accessible tissue: Callus, score: 65.449 N N N N
vg0618930430 C -> DEL N N silent_mutation Average:33.497; most accessible tissue: Callus, score: 65.449 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618930430 1.03E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 1.88E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 NA 1.33E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 2.97E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 7.51E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 1.95E-08 NA mr1121 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 5.70E-07 7.57E-10 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 3.89E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 1.98E-07 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 2.06E-06 3.23E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 6.21E-07 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 2.55E-07 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 2.56E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 5.09E-08 4.41E-09 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 4.23E-08 NA mr1121_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 7.78E-08 6.40E-10 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 3.01E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 1.72E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430 4.40E-08 5.10E-11 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251