Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618930430:

Variant ID: vg0618930430 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18930430
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTCATGTTAAAATGCCTCCCGTTTGGAAGAAAATATTTAACACATTAGTTGTTGCATGAGGGCATAGGATGAAAGGCGCATAAATATACTTATATTT[C/A]
TGGTTTCTTGATGACCAAATGTTAGAAATGATATGTGATGAAACTAGAAACTCGATTATATTTATTTTTTAGCCAAGATATCATCACTCAACATATCCTC

Reverse complement sequence

GAGGATATGTTGAGTGATGATATCTTGGCTAAAAAATAAATATAATCGAGTTTCTAGTTTCATCACATATCATTTCTAACATTTGGTCATCAAGAAACCA[G/T]
AAATATAAGTATATTTATGCGCCTTTCATCCTATGCCCTCATGCAACAACTAATGTGTTAAATATTTTCTTCCAAACGGGAGGCATTTTAACATGAACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.20%	5.40%	3.62%	6.73%	NA
All Indica	2759	85.50%	8.50%	5.44%	0.51%	NA
All Japonica	1512	78.60%	0.90%	1.06%	19.51%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	87.10%	0.00%	11.09%	1.85%	NA
Indica II	465	80.20%	11.60%	8.17%	0.00%	NA
Indica III	913	85.20%	14.10%	0.66%	0.00%	NA
Indica Intermediate	786	87.90%	6.60%	5.09%	0.38%	NA
Temperate Japonica	767	67.00%	1.40%	1.56%	29.99%	NA
Tropical Japonica	504	96.20%	0.20%	0.20%	3.37%	NA
Japonica Intermediate	241	78.40%	0.40%	1.24%	19.92%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	82.20%	8.90%	3.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618930430	C -> A	LOC_Os06g32530.1	downstream_gene_variant ; 3081.0bp to feature; MODIFIER	silent_mutation	Average:33.497; most accessible tissue: Callus, score: 65.449	N	N	N	N
vg0618930430	C -> A	LOC_Os06g32550.1	downstream_gene_variant ; 71.0bp to feature; MODIFIER	silent_mutation	Average:33.497; most accessible tissue: Callus, score: 65.449	N	N	N	N
vg0618930430	C -> A	LOC_Os06g32530-LOC_Os06g32550	intergenic_region ; MODIFIER	silent_mutation	Average:33.497; most accessible tissue: Callus, score: 65.449	N	N	N	N
vg0618930430	C -> DEL	N	N	silent_mutation	Average:33.497; most accessible tissue: Callus, score: 65.449	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618930430	1.03E-06	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	1.88E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	NA	1.33E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	2.97E-06	NA	mr1110	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	7.51E-06	NA	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	1.95E-08	NA	mr1121	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	5.70E-07	7.57E-10	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	3.89E-06	NA	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	1.98E-07	NA	mr1211	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	2.06E-06	3.23E-10	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	6.21E-07	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	2.55E-07	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	2.56E-06	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	5.09E-08	4.41E-09	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	4.23E-08	NA	mr1121_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	7.78E-08	6.40E-10	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	3.01E-06	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	1.72E-06	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618930430	4.40E-08	5.10E-11	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251