Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0618906581:

Variant ID: vg0618906581 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18906581
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACGGACGACCGTCATCCTTATCGGGCCTAAATAAAAGACCCAAACTCATCTATGACGGGTCATAGTTAAGACCCGTCACGGATAAGAGTTATCCGTGAT[G/A]
TTTCAAGCTCCTACTTCCAAGAACTGACTTTTTTGTCCCCAAGAGTGATGTCTGGCTTGCCGCCGATCTCGACCGGGTCGCTGCCATTGACTTGTCTACG

Reverse complement sequence

CGTAGACAAGTCAATGGCAGCGACCCGGTCGAGATCGGCGGCAAGCCAGACATCACTCTTGGGGACAAAAAAGTCAGTTCTTGGAAGTAGGAGCTTGAAA[C/T]
ATCACGGATAACTCTTATCCGTGACGGGTCTTAACTATGACCCGTCATAGATGAGTTTGGGTCTTTTATTTAGGCCCGATAAGGATGACGGTCGTCCGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	0.40%	0.17%	6.67%	NA
All Indica	2759	99.50%	0.00%	0.04%	0.47%	NA
All Japonica	1512	79.00%	1.10%	0.46%	19.38%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	0.20%	0.17%	1.68%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.00%	0.38%	NA
Temperate Japonica	767	67.70%	1.60%	0.91%	29.86%	NA
Tropical Japonica	504	96.60%	0.00%	0.00%	3.37%	NA
Japonica Intermediate	241	78.40%	2.10%	0.00%	19.50%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	93.30%	0.00%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618906581	G -> A	LOC_Os06g32510.1	upstream_gene_variant ; 2506.0bp to feature; MODIFIER	silent_mutation	Average:54.336; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0618906581	G -> A	LOC_Os06g32500.1	intron_variant ; MODIFIER	silent_mutation	Average:54.336; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0618906581	G -> DEL	N	N	silent_mutation	Average:54.336; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618906581	4.27E-06	1.14E-08	mr1354	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	NA	9.28E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	NA	4.50E-06	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	NA	5.37E-07	mr1577_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	5.00E-07	5.00E-07	mr1587_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	NA	7.17E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	NA	9.62E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	NA	1.21E-08	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618906581	NA	4.32E-07	mr1792_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251