\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618903529:

Variant ID: vg0618903529 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18903529
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAATAATAAATTCCAATATAAAATTGGGCTTCATAAAATTTTATTAAATACTTTGCTTGATTCTATAGTTCCTAGATTTTTCTGGGATTTATTTGAGC[T/C]
AAGGAAGTATTTTTAATAAATGGAATTGCACTTCATGAATAATTTAAATGAAAAAGTTTTAAAAATCTCTCTTTTGGCTTTGGGCCGAAAGTCGGCCCAA

Reverse complement sequence

TTGGGCCGACTTTCGGCCCAAAGCCAAAAGAGAGATTTTTAAAACTTTTTCATTTAAATTATTCATGAAGTGCAATTCCATTTATTAAAAATACTTCCTT[A/G]
GCTCAAATAAATCCCAGAAAAATCTAGGAACTATAGAATCAAGCAAAGTATTTAATAAAATTTTATGAAGCCCAATTTTATATTGGAATTTATTATTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 24.90% 0.38% 6.90% NA
All Indica  2759 97.10% 2.40% 0.07% 0.51% NA
All Japonica  1512 7.20% 71.90% 0.66% 20.24% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.30% 0.00% 1.85% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 98.90% 1.00% 0.11% 0.00% NA
Indica Intermediate  786 94.90% 4.60% 0.13% 0.38% NA
Temperate Japonica  767 3.90% 63.80% 0.65% 31.68% NA
Tropical Japonica  504 13.30% 83.50% 0.60% 2.58% NA
Japonica Intermediate  241 5.00% 73.40% 0.83% 20.75% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 62.20% 28.90% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618903529 T -> C LOC_Os06g32500.1 intron_variant ; MODIFIER silent_mutation Average:35.18; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg0618903529 T -> DEL N N silent_mutation Average:35.18; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618903529 NA 1.15E-10 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.13E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.20E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 3.90E-24 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 4.82E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 3.24E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.76E-21 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.20E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.84E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 2.64E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 7.03E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 5.64E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 9.25E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 8.68E-13 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 2.07E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 9.07E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 8.56E-08 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 2.99E-09 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 2.28E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 6.16E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.94E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 3.23E-06 1.07E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 7.86E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 8.57E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.69E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 3.21E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 2.02E-18 mr1686_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 2.06E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 2.80E-17 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 1.96E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 9.09E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 NA 3.68E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618903529 5.48E-06 5.48E-06 mr1981_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251