\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618886684:

Variant ID: vg0618886684 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18886684
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTTCTTTAGTTACACATTATCATTCTAAAAAGTATCTCTACATAGTTTAAAATGTCTCAACAAAATGCCTTTACATATTAAACGCATTTTATAGTG[C/T]
CGAAAGAATGCCTCTATAAGATAAGATCTAACAAACTGAGCTAAAATTGTCTCTAGAGTAAAAGTTTTCTAGATAATTTTTGAAGTGTCTCTACACTATA

Reverse complement sequence

TATAGTGTAGAGACACTTCAAAAATTATCTAGAAAACTTTTACTCTAGAGACAATTTTAGCTCAGTTTGTTAGATCTTATCTTATAGAGGCATTCTTTCG[G/A]
CACTATAAAATGCGTTTAATATGTAAAGGCATTTTGTTGAGACATTTTAAACTATGTAGAGATACTTTTTAGAATGATAATGTGTAACTAAAGAAACAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 0.50% 1.86% 2.22% NA
All Indica  2759 99.70% 0.00% 0.18% 0.14% NA
All Japonica  1512 86.50% 1.60% 5.42% 6.48% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.00% 0.50% 0.50% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.00% 0.25% 0.13% NA
Temperate Japonica  767 80.70% 2.20% 8.21% 8.87% NA
Tropical Japonica  504 96.80% 0.40% 1.59% 1.19% NA
Japonica Intermediate  241 83.40% 2.10% 4.56% 9.96% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 96.70% 0.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618886684 C -> T LOC_Os06g32470.1 upstream_gene_variant ; 3840.0bp to feature; MODIFIER silent_mutation Average:32.139; most accessible tissue: Callus, score: 60.602 N N N N
vg0618886684 C -> T LOC_Os06g32480.1 downstream_gene_variant ; 1357.0bp to feature; MODIFIER silent_mutation Average:32.139; most accessible tissue: Callus, score: 60.602 N N N N
vg0618886684 C -> T LOC_Os06g32490.1 downstream_gene_variant ; 3643.0bp to feature; MODIFIER silent_mutation Average:32.139; most accessible tissue: Callus, score: 60.602 N N N N
vg0618886684 C -> T LOC_Os06g32480-LOC_Os06g32490 intergenic_region ; MODIFIER silent_mutation Average:32.139; most accessible tissue: Callus, score: 60.602 N N N N
vg0618886684 C -> DEL N N silent_mutation Average:32.139; most accessible tissue: Callus, score: 60.602 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618886684 NA 6.78E-06 mr1049_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 1.10E-06 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 3.86E-10 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 1.48E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 2.45E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 1.72E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 1.95E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 1.01E-06 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 1.63E-06 1.63E-06 mr1587_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 1.72E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 4.06E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 8.53E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 3.14E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 2.24E-08 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 9.85E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 6.78E-08 mr1792_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 NA 2.97E-06 mr1803_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 7.11E-06 7.11E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684 8.71E-06 8.71E-06 mr1981_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251