Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618886684:

Variant ID: vg0618886684 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18886684
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGTTTCTTTAGTTACACATTATCATTCTAAAAAGTATCTCTACATAGTTTAAAATGTCTCAACAAAATGCCTTTACATATTAAACGCATTTTATAGTG[C/T]
CGAAAGAATGCCTCTATAAGATAAGATCTAACAAACTGAGCTAAAATTGTCTCTAGAGTAAAAGTTTTCTAGATAATTTTTGAAGTGTCTCTACACTATA

Reverse complement sequence

TATAGTGTAGAGACACTTCAAAAATTATCTAGAAAACTTTTACTCTAGAGACAATTTTAGCTCAGTTTGTTAGATCTTATCTTATAGAGGCATTCTTTCG[G/A]
CACTATAAAATGCGTTTAATATGTAAAGGCATTTTGTTGAGACATTTTAAACTATGTAGAGATACTTTTTAGAATGATAATGTGTAACTAAAGAAACAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.40%	0.50%	1.86%	2.22%	NA
All Indica	2759	99.70%	0.00%	0.18%	0.14%	NA
All Japonica	1512	86.50%	1.60%	5.42%	6.48%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.00%	0.50%	0.50%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.25%	0.13%	NA
Temperate Japonica	767	80.70%	2.20%	8.21%	8.87%	NA
Tropical Japonica	504	96.80%	0.40%	1.59%	1.19%	NA
Japonica Intermediate	241	83.40%	2.10%	4.56%	9.96%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	96.70%	0.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618886684	C -> T	LOC_Os06g32470.1	upstream_gene_variant ; 3840.0bp to feature; MODIFIER	silent_mutation	Average:32.139; most accessible tissue: Callus, score: 60.602	N	N	N	N
vg0618886684	C -> T	LOC_Os06g32480.1	downstream_gene_variant ; 1357.0bp to feature; MODIFIER	silent_mutation	Average:32.139; most accessible tissue: Callus, score: 60.602	N	N	N	N
vg0618886684	C -> T	LOC_Os06g32490.1	downstream_gene_variant ; 3643.0bp to feature; MODIFIER	silent_mutation	Average:32.139; most accessible tissue: Callus, score: 60.602	N	N	N	N
vg0618886684	C -> T	LOC_Os06g32480-LOC_Os06g32490	intergenic_region ; MODIFIER	silent_mutation	Average:32.139; most accessible tissue: Callus, score: 60.602	N	N	N	N
vg0618886684	C -> DEL	N	N	silent_mutation	Average:32.139; most accessible tissue: Callus, score: 60.602	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618886684	NA	6.78E-06	mr1049_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	1.10E-06	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	3.86E-10	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	1.48E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	2.45E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	1.72E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	1.95E-07	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	1.01E-06	mr1577_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	1.63E-06	1.63E-06	mr1587_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	1.72E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	4.06E-06	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	8.53E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	3.14E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	2.24E-08	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	9.85E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	6.78E-08	mr1792_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	NA	2.97E-06	mr1803_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	7.11E-06	7.11E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618886684	8.71E-06	8.71E-06	mr1981_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251