Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618883511:

Variant ID: vg0618883511 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18883511
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTCCCGAAGTTCGGATCACACGAATCCTACTCTCCGTTGAGGTGCTCCAAAGAGCCGGGTCTCGATTAACCCCTTGGCTCACTTATGCAAAGATCC[C/T]
AGAAGAGGTCCACAGCCTTCAACTCAACACTTCTAGGTTATTTTCTAGAATTGAGAGACCACCAAGATCCAACTCAAAATTTCTTCTAGAAAAGACCACA

Reverse complement sequence

TGTGGTCTTTTCTAGAAGAAATTTTGAGTTGGATCTTGGTGGTCTCTCAATTCTAGAAAATAACCTAGAAGTGTTGAGTTGAAGGCTGTGGACCTCTTCT[G/A]
GGATCTTTGCATAAGTGAGCCAAGGGGTTAATCGAGACCCGGCTCTTTGGAGCACCTCAACGGAGAGTAGGATTCGTGTGATCCGAACTTCGGGAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	7.00%	0.15%	0.78%	NA
All Indica	2759	98.30%	0.50%	0.18%	0.98%	NA
All Japonica	1512	79.00%	20.60%	0.07%	0.33%	NA
Aus	269	98.50%	0.00%	0.00%	1.49%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.00%	0.00%	0.22%	1.75%	NA
Indica Intermediate	786	97.80%	0.40%	0.38%	1.40%	NA
Temperate Japonica	767	68.30%	31.70%	0.00%	0.00%	NA
Tropical Japonica	504	95.60%	3.40%	0.00%	0.99%	NA
Japonica Intermediate	241	78.00%	21.60%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	1.00%	1.04%	1.04%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618883511	C -> T	LOC_Os06g32470.1	upstream_gene_variant ; 667.0bp to feature; MODIFIER	silent_mutation	Average:32.826; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0618883511	C -> T	LOC_Os06g32480.1	upstream_gene_variant ; 1455.0bp to feature; MODIFIER	silent_mutation	Average:32.826; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0618883511	C -> T	LOC_Os06g32470-LOC_Os06g32480	intergenic_region ; MODIFIER	silent_mutation	Average:32.826; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0618883511	C -> DEL	N	N	silent_mutation	Average:32.826; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618883511	NA	8.73E-07	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	9.16E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	6.01E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	2.13E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	2.78E-07	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	7.47E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	1.22E-08	mr1624_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	9.22E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	1.98E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	6.05E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	3.48E-06	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	9.42E-07	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	8.04E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	NA	1.25E-07	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	2.72E-07	2.72E-07	mr1914_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618883511	5.65E-06	5.66E-06	mr1927_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251