Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0618821836:

Variant ID: vg0618821836 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18821836
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAAGCAAACACAAAGGCGAGTACATCTTTGAACATCAAAACATCCAAAGCTGCCCCTTCAAGAAATCAAGAAAAGAAACAATTTAACTGCAAACACA[T/A]
GTGTAAAGCAAGATCTGGATATCAAAACACCCAAATCTGCCCATCTTGCAGTATGTACGAAACTTCAAAGAAACCTAAATTCACTGCTAAACCCAATACT

Reverse complement sequence

AGTATTGGGTTTAGCAGTGAATTTAGGTTTCTTTGAAGTTTCGTACATACTGCAAGATGGGCAGATTTGGGTGTTTTGATATCCAGATCTTGCTTTACAC[A/T]
TGTGTTTGCAGTTAAATTGTTTCTTTTCTTGATTTCTTGAAGGGGCAGCTTTGGATGTTTTGATGTTCAAAGATGTACTCGCCTTTGTGTTTGCTTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	27.10%	0.23%	8.82%	NA
All Indica	2759	93.80%	2.90%	0.25%	3.04%	NA
All Japonica	1512	6.90%	71.50%	0.13%	21.49%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.40%	1.20%	0.34%	5.04%	NA
Indica II	465	95.10%	3.90%	0.22%	0.86%	NA
Indica III	913	97.00%	1.40%	0.22%	1.31%	NA
Indica Intermediate	786	89.70%	5.20%	0.25%	4.83%	NA
Temperate Japonica	767	3.80%	65.10%	0.26%	30.90%	NA
Tropical Japonica	504	13.10%	80.80%	0.00%	6.15%	NA
Japonica Intermediate	241	3.70%	72.60%	0.00%	23.65%	NA
VI/Aromatic	96	6.20%	87.50%	1.04%	5.21%	NA
Intermediate	90	54.40%	41.10%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618821836	T -> A	LOC_Os06g32340.1	upstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N
vg0618821836	T -> A	LOC_Os06g32330.1	downstream_gene_variant ; 4111.0bp to feature; MODIFIER	silent_mutation	Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N
vg0618821836	T -> A	LOC_Os06g32330-LOC_Os06g32340	intergenic_region ; MODIFIER	silent_mutation	Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N
vg0618821836	T -> DEL	N	N	silent_mutation	Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618821836	NA	4.54E-08	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836	NA	2.91E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836	7.48E-07	1.08E-09	mr1681	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836	NA	6.78E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836	NA	2.40E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836	NA	4.53E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251