\
| Variant ID: vg0618821836 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18821836 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 213. )
AGAAAAGCAAACACAAAGGCGAGTACATCTTTGAACATCAAAACATCCAAAGCTGCCCCTTCAAGAAATCAAGAAAAGAAACAATTTAACTGCAAACACA[T/A]
GTGTAAAGCAAGATCTGGATATCAAAACACCCAAATCTGCCCATCTTGCAGTATGTACGAAACTTCAAAGAAACCTAAATTCACTGCTAAACCCAATACT
AGTATTGGGTTTAGCAGTGAATTTAGGTTTCTTTGAAGTTTCGTACATACTGCAAGATGGGCAGATTTGGGTGTTTTGATATCCAGATCTTGCTTTACAC[A/T]
TGTGTTTGCAGTTAAATTGTTTCTTTTCTTGATTTCTTGAAGGGGCAGCTTTGGATGTTTTGATGTTCAAAGATGTACTCGCCTTTGTGTTTGCTTTTCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 27.10% | 0.23% | 8.82% | NA |
| All Indica | 2759 | 93.80% | 2.90% | 0.25% | 3.04% | NA |
| All Japonica | 1512 | 6.90% | 71.50% | 0.13% | 21.49% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 1.20% | 0.34% | 5.04% | NA |
| Indica II | 465 | 95.10% | 3.90% | 0.22% | 0.86% | NA |
| Indica III | 913 | 97.00% | 1.40% | 0.22% | 1.31% | NA |
| Indica Intermediate | 786 | 89.70% | 5.20% | 0.25% | 4.83% | NA |
| Temperate Japonica | 767 | 3.80% | 65.10% | 0.26% | 30.90% | NA |
| Tropical Japonica | 504 | 13.10% | 80.80% | 0.00% | 6.15% | NA |
| Japonica Intermediate | 241 | 3.70% | 72.60% | 0.00% | 23.65% | NA |
| VI/Aromatic | 96 | 6.20% | 87.50% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 54.40% | 41.10% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618821836 | T -> A | LOC_Os06g32340.1 | upstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 | N | N | N | N |
| vg0618821836 | T -> A | LOC_Os06g32330.1 | downstream_gene_variant ; 4111.0bp to feature; MODIFIER | silent_mutation | Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 | N | N | N | N |
| vg0618821836 | T -> A | LOC_Os06g32330-LOC_Os06g32340 | intergenic_region ; MODIFIER | silent_mutation | Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 | N | N | N | N |
| vg0618821836 | T -> DEL | N | N | silent_mutation | Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618821836 | NA | 4.54E-08 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618821836 | NA | 2.91E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618821836 | 7.48E-07 | 1.08E-09 | mr1681 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618821836 | NA | 6.78E-08 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618821836 | NA | 2.40E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618821836 | NA | 4.53E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |