\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618821836:

Variant ID: vg0618821836 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18821836
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAAAGCAAACACAAAGGCGAGTACATCTTTGAACATCAAAACATCCAAAGCTGCCCCTTCAAGAAATCAAGAAAAGAAACAATTTAACTGCAAACACA[T/A]
GTGTAAAGCAAGATCTGGATATCAAAACACCCAAATCTGCCCATCTTGCAGTATGTACGAAACTTCAAAGAAACCTAAATTCACTGCTAAACCCAATACT

Reverse complement sequence

AGTATTGGGTTTAGCAGTGAATTTAGGTTTCTTTGAAGTTTCGTACATACTGCAAGATGGGCAGATTTGGGTGTTTTGATATCCAGATCTTGCTTTACAC[A/T]
TGTGTTTGCAGTTAAATTGTTTCTTTTCTTGATTTCTTGAAGGGGCAGCTTTGGATGTTTTGATGTTCAAAGATGTACTCGCCTTTGTGTTTGCTTTTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 27.10% 0.23% 8.82% NA
All Indica  2759 93.80% 2.90% 0.25% 3.04% NA
All Japonica  1512 6.90% 71.50% 0.13% 21.49% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.40% 1.20% 0.34% 5.04% NA
Indica II  465 95.10% 3.90% 0.22% 0.86% NA
Indica III  913 97.00% 1.40% 0.22% 1.31% NA
Indica Intermediate  786 89.70% 5.20% 0.25% 4.83% NA
Temperate Japonica  767 3.80% 65.10% 0.26% 30.90% NA
Tropical Japonica  504 13.10% 80.80% 0.00% 6.15% NA
Japonica Intermediate  241 3.70% 72.60% 0.00% 23.65% NA
VI/Aromatic  96 6.20% 87.50% 1.04% 5.21% NA
Intermediate  90 54.40% 41.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618821836 T -> A LOC_Os06g32340.1 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N
vg0618821836 T -> A LOC_Os06g32330.1 downstream_gene_variant ; 4111.0bp to feature; MODIFIER silent_mutation Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N
vg0618821836 T -> A LOC_Os06g32330-LOC_Os06g32340 intergenic_region ; MODIFIER silent_mutation Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N
vg0618821836 T -> DEL N N silent_mutation Average:64.312; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618821836 NA 4.54E-08 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836 NA 2.91E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836 7.48E-07 1.08E-09 mr1681 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836 NA 6.78E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836 NA 2.40E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618821836 NA 4.53E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251