\
| Variant ID: vg0618817199 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18817199 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGACCCTAGGGATAAACTACACTGGGAACGGCATAGGAGCGGCGGTTGCCGGCGAACCACGGCACAATAATGCAAATGGAGGGCACCGGGAGAAAGAGGA[G/C]
GCAATGGCGATGCTTACCAACACTTAAACAGCGATGAACGGCGAAGGAGATGGCCGGCGACGAGATTGGGACGGCGGCGAGGTTCGGGTCCACGGCGGCG
CGCCGCCGTGGACCCGAACCTCGCCGCCGTCCCAATCTCGTCGCCGGCCATCTCCTTCGCCGTTCATCGCTGTTTAAGTGTTGGTAAGCATCGCCATTGC[C/G]
TCCTCTTTCTCCCGGTGCCCTCCATTTGCATTATTGTGCCGTGGTTCGCCGGCAACCGCCGCTCCTATGCCGTTCCCAGTGTAGTTTATCCCTAGGGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 7.60% | 5.14% | 3.55% | NA |
| All Indica | 2759 | 77.70% | 12.80% | 8.01% | 1.45% | NA |
| All Japonica | 1512 | 90.50% | 0.20% | 1.06% | 8.20% | NA |
| Aus | 269 | 98.10% | 0.40% | 1.49% | 0.00% | NA |
| Indica I | 595 | 77.10% | 3.00% | 17.65% | 2.18% | NA |
| Indica II | 465 | 84.50% | 7.10% | 7.96% | 0.43% | NA |
| Indica III | 913 | 74.40% | 23.10% | 1.75% | 0.77% | NA |
| Indica Intermediate | 786 | 78.10% | 11.60% | 8.02% | 2.29% | NA |
| Temperate Japonica | 767 | 88.10% | 0.40% | 0.78% | 10.69% | NA |
| Tropical Japonica | 504 | 94.80% | 0.00% | 0.99% | 4.17% | NA |
| Japonica Intermediate | 241 | 89.20% | 0.00% | 2.07% | 8.71% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618817199 | G -> C | LOC_Os06g32320.1 | upstream_gene_variant ; 4940.0bp to feature; MODIFIER | silent_mutation | Average:62.48; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| vg0618817199 | G -> C | LOC_Os06g32330.1 | upstream_gene_variant ; 50.0bp to feature; MODIFIER | silent_mutation | Average:62.48; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| vg0618817199 | G -> C | LOC_Os06g32320-LOC_Os06g32330 | intergenic_region ; MODIFIER | silent_mutation | Average:62.48; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| vg0618817199 | G -> DEL | N | N | silent_mutation | Average:62.48; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618817199 | 7.90E-06 | NA | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 2.82E-06 | NA | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 9.04E-06 | 5.52E-10 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 5.95E-06 | NA | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 3.12E-06 | NA | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 3.84E-09 | 3.14E-09 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 7.70E-07 | 2.61E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 5.47E-06 | NA | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | NA | 5.27E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 8.01E-10 | 3.58E-08 | mr1111_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 8.55E-06 | NA | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 5.06E-06 | 6.50E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 1.57E-08 | 4.92E-08 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 6.24E-07 | 2.52E-07 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 2.08E-06 | NA | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | 3.35E-07 | NA | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618817199 | NA | 2.20E-07 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |