Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618738442:

Variant ID: vg0618738442 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18738442
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 141. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTTTTTTTTCTTTGGAAGAACTTTGGAGGAAGAGGCATAAATGACATGGAGTATTTATTTTGTGGACTATGGATGAAATGAATGGTAAATGAGCAATG[C/T]
TGACTTCCAATGTAGAAGTCAAGCATTTATGTGTGTATGTGGAATGTGTGTGATCTTGACCATGAAAGTATGAAAAGCATTTCACTAGGGTCACAAAACT

Reverse complement sequence

AGTTTTGTGACCCTAGTGAAATGCTTTTCATACTTTCATGGTCAAGATCACACACATTCCACATACACACATAAATGCTTGACTTCTACATTGGAAGTCA[G/A]
CATTGCTCATTTACCATTCATTTCATCCATAGTCCACAAAATAAATACTCCATGTCATTTATGCCTCTTCCTCCAAAGTTCTTCCAAAGAAAAAAAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	31.50%	0.63%	1.61%	NA
All Indica	2759	93.60%	5.90%	0.04%	0.43%	NA
All Japonica	1512	9.10%	85.40%	1.72%	3.77%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	92.80%	5.50%	0.00%	1.68%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	96.90%	3.00%	0.00%	0.11%	NA
Indica Intermediate	786	89.70%	10.10%	0.13%	0.13%	NA
Temperate Japonica	767	7.80%	87.10%	0.65%	4.43%	NA
Tropical Japonica	504	13.10%	83.50%	2.78%	0.60%	NA
Japonica Intermediate	241	5.00%	83.80%	2.90%	8.30%	NA
VI/Aromatic	96	91.70%	1.00%	1.04%	6.25%	NA
Intermediate	90	61.10%	35.60%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618738442	C -> T	LOC_Os06g32170.1	upstream_gene_variant ; 3874.0bp to feature; MODIFIER	silent_mutation	Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg0618738442	C -> T	LOC_Os06g32180.1	downstream_gene_variant ; 555.0bp to feature; MODIFIER	silent_mutation	Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg0618738442	C -> T	LOC_Os06g32170-LOC_Os06g32180	intergenic_region ; MODIFIER	silent_mutation	Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg0618738442	C -> DEL	N	N	silent_mutation	Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618738442	NA	6.33E-08	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	7.93E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	2.67E-08	2.67E-08	mr1536	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	8.50E-08	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	1.51E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	6.50E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	1.67E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	5.61E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	8.88E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442	NA	1.06E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251