\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618738442:

Variant ID: vg0618738442 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18738442
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 141. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTTTTTTCTTTGGAAGAACTTTGGAGGAAGAGGCATAAATGACATGGAGTATTTATTTTGTGGACTATGGATGAAATGAATGGTAAATGAGCAATG[C/T]
TGACTTCCAATGTAGAAGTCAAGCATTTATGTGTGTATGTGGAATGTGTGTGATCTTGACCATGAAAGTATGAAAAGCATTTCACTAGGGTCACAAAACT

Reverse complement sequence

AGTTTTGTGACCCTAGTGAAATGCTTTTCATACTTTCATGGTCAAGATCACACACATTCCACATACACACATAAATGCTTGACTTCTACATTGGAAGTCA[G/A]
CATTGCTCATTTACCATTCATTTCATCCATAGTCCACAAAATAAATACTCCATGTCATTTATGCCTCTTCCTCCAAAGTTCTTCCAAAGAAAAAAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 31.50% 0.63% 1.61% NA
All Indica  2759 93.60% 5.90% 0.04% 0.43% NA
All Japonica  1512 9.10% 85.40% 1.72% 3.77% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 92.80% 5.50% 0.00% 1.68% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 96.90% 3.00% 0.00% 0.11% NA
Indica Intermediate  786 89.70% 10.10% 0.13% 0.13% NA
Temperate Japonica  767 7.80% 87.10% 0.65% 4.43% NA
Tropical Japonica  504 13.10% 83.50% 2.78% 0.60% NA
Japonica Intermediate  241 5.00% 83.80% 2.90% 8.30% NA
VI/Aromatic  96 91.70% 1.00% 1.04% 6.25% NA
Intermediate  90 61.10% 35.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618738442 C -> T LOC_Os06g32170.1 upstream_gene_variant ; 3874.0bp to feature; MODIFIER silent_mutation Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg0618738442 C -> T LOC_Os06g32180.1 downstream_gene_variant ; 555.0bp to feature; MODIFIER silent_mutation Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg0618738442 C -> T LOC_Os06g32170-LOC_Os06g32180 intergenic_region ; MODIFIER silent_mutation Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg0618738442 C -> DEL N N silent_mutation Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618738442 NA 6.33E-08 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 7.93E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 2.67E-08 2.67E-08 mr1536 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 8.50E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 1.51E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 6.50E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 1.67E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 5.61E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 8.88E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618738442 NA 1.06E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251