\
| Variant ID: vg0618738442 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18738442 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 141. )
TCTTTTTTTTTCTTTGGAAGAACTTTGGAGGAAGAGGCATAAATGACATGGAGTATTTATTTTGTGGACTATGGATGAAATGAATGGTAAATGAGCAATG[C/T]
TGACTTCCAATGTAGAAGTCAAGCATTTATGTGTGTATGTGGAATGTGTGTGATCTTGACCATGAAAGTATGAAAAGCATTTCACTAGGGTCACAAAACT
AGTTTTGTGACCCTAGTGAAATGCTTTTCATACTTTCATGGTCAAGATCACACACATTCCACATACACACATAAATGCTTGACTTCTACATTGGAAGTCA[G/A]
CATTGCTCATTTACCATTCATTTCATCCATAGTCCACAAAATAAATACTCCATGTCATTTATGCCTCTTCCTCCAAAGTTCTTCCAAAGAAAAAAAAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 31.50% | 0.63% | 1.61% | NA |
| All Indica | 2759 | 93.60% | 5.90% | 0.04% | 0.43% | NA |
| All Japonica | 1512 | 9.10% | 85.40% | 1.72% | 3.77% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 5.50% | 0.00% | 1.68% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 89.70% | 10.10% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 7.80% | 87.10% | 0.65% | 4.43% | NA |
| Tropical Japonica | 504 | 13.10% | 83.50% | 2.78% | 0.60% | NA |
| Japonica Intermediate | 241 | 5.00% | 83.80% | 2.90% | 8.30% | NA |
| VI/Aromatic | 96 | 91.70% | 1.00% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 61.10% | 35.60% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618738442 | C -> T | LOC_Os06g32170.1 | upstream_gene_variant ; 3874.0bp to feature; MODIFIER | silent_mutation | Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 | N | N | N | N |
| vg0618738442 | C -> T | LOC_Os06g32180.1 | downstream_gene_variant ; 555.0bp to feature; MODIFIER | silent_mutation | Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 | N | N | N | N |
| vg0618738442 | C -> T | LOC_Os06g32170-LOC_Os06g32180 | intergenic_region ; MODIFIER | silent_mutation | Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 | N | N | N | N |
| vg0618738442 | C -> DEL | N | N | silent_mutation | Average:27.908; most accessible tissue: Minghui63 flag leaf, score: 41.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618738442 | NA | 6.33E-08 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 7.93E-06 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | 2.67E-08 | 2.67E-08 | mr1536 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 8.50E-08 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 1.51E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 6.50E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 1.67E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 5.61E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 8.88E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618738442 | NA | 1.06E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |