Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0618666330:

Variant ID: vg0618666330 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18666330
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGTCTCCGGGTAATAGCTACTTCTGCTATTTGATGCAAGGGTCGATAACTTTGCCTTTGAATTATGCTTCCCAAGAGAACCAACTTATCCCACTTGAC[A/C]
TACTTTGACGTCTTCCCAAATGACTTTATTGCTGGATTTGTTATTGTCTAATCATTATCCTGCCAAATCTGAGGCTTCGTTGTTAGATGTGCTTTTAATC

Reverse complement sequence

GATTAAAAGCACATCTAACAACGAAGCCTCAGATTTGGCAGGATAATGATTAGACAATAACAAATCCAGCAATAAAGTCATTTGGGAAGACGTCAAAGTA[T/G]
GTCAAGTGGGATAAGTTGGTTCTCTTGGGAAGCATAATTCAAAGGCAAAGTTATCGACCCTTGCATCAAATAGCAGAAGTAGCTATTACCCGGAGACCGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.70%	0.20%	2.09%	60.03%	NA
All Indica	2759	12.40%	0.40%	1.23%	86.01%	NA
All Japonica	1512	87.60%	0.00%	3.57%	8.86%	NA
Aus	269	7.10%	0.00%	1.12%	91.82%	NA
Indica I	595	20.50%	0.20%	0.84%	78.49%	NA
Indica II	465	15.30%	0.90%	1.29%	82.58%	NA
Indica III	913	3.30%	0.00%	0.99%	95.73%	NA
Indica Intermediate	786	15.10%	0.60%	1.78%	82.44%	NA
Temperate Japonica	767	88.40%	0.00%	1.17%	10.43%	NA
Tropical Japonica	504	86.30%	0.00%	6.75%	6.94%	NA
Japonica Intermediate	241	87.60%	0.00%	4.56%	7.88%	NA
VI/Aromatic	96	49.00%	0.00%	4.17%	46.88%	NA
Intermediate	90	53.30%	0.00%	4.44%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618666330	A -> C	LOC_Os06g32080.1	downstream_gene_variant ; 4616.0bp to feature; MODIFIER	silent_mutation	Average:4.824; most accessible tissue: Callus, score: 8.39	N	N	N	N
vg0618666330	A -> C	LOC_Os06g32090.1	downstream_gene_variant ; 2743.0bp to feature; MODIFIER	silent_mutation	Average:4.824; most accessible tissue: Callus, score: 8.39	N	N	N	N
vg0618666330	A -> C	LOC_Os06g32080-LOC_Os06g32090	intergenic_region ; MODIFIER	silent_mutation	Average:4.824; most accessible tissue: Callus, score: 8.39	N	N	N	N
vg0618666330	A -> DEL	N	N	silent_mutation	Average:4.824; most accessible tissue: Callus, score: 8.39	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618666330	5.36E-06	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618666330	NA	1.74E-06	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618666330	2.38E-06	NA	mr1129	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618666330	NA	1.66E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618666330	7.87E-06	NA	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618666330	NA	6.29E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251