\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618618072:

Variant ID: vg0618618072 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18618072
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGGGGTCCGGGCCGCCGCCTCCATGTCGTCCGCCGCCGCTGCACCTCCCCTCCCCCCGATCTAGTTGACGGGAGGGCGTCGCTACCTCTCCTGCCGCT[G/A]
CCGCAGAGAGAGAGAGAGACACAGAGAGAGAGGAGAAGCGTTGCTACCTCTCCCACCGCTGCCGCAGAGAGAGAGGAGAAGCCGAGAGAAGGGCTCGTCC

Reverse complement sequence

GGACGAGCCCTTCTCTCGGCTTCTCCTCTCTCTCTGCGGCAGCGGTGGGAGAGGTAGCAACGCTTCTCCTCTCTCTCTGTGTCTCTCTCTCTCTCTGCGG[C/T]
AGCGGCAGGAGAGGTAGCGACGCCCTCCCGTCAACTAGATCGGGGGGAGGGGAGGTGCAGCGGCGGCGGACGACATGGAGGCGGCGGCCCGGACCCCCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.90% 5.00% 8.48% 50.57% NA
All Indica  2759 11.60% 4.20% 8.12% 76.08% NA
All Japonica  1512 87.10% 1.40% 2.51% 8.99% NA
Aus  269 2.20% 34.20% 21.19% 42.38% NA
Indica I  595 20.00% 3.20% 6.39% 70.42% NA
Indica II  465 10.50% 3.40% 1.94% 84.09% NA
Indica III  913 3.40% 4.20% 12.71% 79.74% NA
Indica Intermediate  786 15.30% 5.60% 7.76% 71.37% NA
Temperate Japonica  767 88.30% 0.30% 1.43% 10.04% NA
Tropical Japonica  504 85.50% 3.60% 4.17% 6.75% NA
Japonica Intermediate  241 86.70% 0.40% 2.49% 10.37% NA
VI/Aromatic  96 13.50% 1.00% 77.08% 8.33% NA
Intermediate  90 47.80% 6.70% 8.89% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618618072 G -> A LOC_Os06g32020.1 upstream_gene_variant ; 1269.0bp to feature; MODIFIER silent_mutation Average:14.975; most accessible tissue: Callus, score: 27.977 N N N N
vg0618618072 G -> A LOC_Os06g32030.1 downstream_gene_variant ; 4162.0bp to feature; MODIFIER silent_mutation Average:14.975; most accessible tissue: Callus, score: 27.977 N N N N
vg0618618072 G -> A LOC_Os06g32020-LOC_Os06g32030 intergenic_region ; MODIFIER silent_mutation Average:14.975; most accessible tissue: Callus, score: 27.977 N N N N
vg0618618072 G -> DEL N N silent_mutation Average:14.975; most accessible tissue: Callus, score: 27.977 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618618072 1.62E-09 4.02E-76 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 2.28E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 4.64E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 2.37E-07 3.63E-08 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 2.74E-07 1.01E-07 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.39E-06 1.14E-07 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 9.80E-09 3.45E-10 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 7.63E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.75E-08 8.68E-10 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 4.80E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.57E-09 5.00E-11 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 3.66E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 2.95E-08 1.23E-09 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.77E-06 1.61E-07 mr1619 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 5.35E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 8.43E-07 mr1993 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 4.21E-11 1.21E-101 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 2.47E-12 mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.24E-08 4.29E-11 mr1071_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 2.21E-09 2.27E-10 mr1080_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 6.32E-11 1.03E-12 mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.82E-09 1.54E-11 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.03E-06 3.29E-09 mr1402_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 9.73E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 6.67E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 1.81E-08 3.34E-09 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 2.55E-06 5.18E-09 mr1795_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618618072 NA 2.22E-06 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251