\
| Variant ID: vg0618618072 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18618072 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGGGGGGTCCGGGCCGCCGCCTCCATGTCGTCCGCCGCCGCTGCACCTCCCCTCCCCCCGATCTAGTTGACGGGAGGGCGTCGCTACCTCTCCTGCCGCT[G/A]
CCGCAGAGAGAGAGAGAGACACAGAGAGAGAGGAGAAGCGTTGCTACCTCTCCCACCGCTGCCGCAGAGAGAGAGGAGAAGCCGAGAGAAGGGCTCGTCC
GGACGAGCCCTTCTCTCGGCTTCTCCTCTCTCTCTGCGGCAGCGGTGGGAGAGGTAGCAACGCTTCTCCTCTCTCTCTGTGTCTCTCTCTCTCTCTGCGG[C/T]
AGCGGCAGGAGAGGTAGCGACGCCCTCCCGTCAACTAGATCGGGGGGAGGGGAGGTGCAGCGGCGGCGGACGACATGGAGGCGGCGGCCCGGACCCCCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.90% | 5.00% | 8.48% | 50.57% | NA |
| All Indica | 2759 | 11.60% | 4.20% | 8.12% | 76.08% | NA |
| All Japonica | 1512 | 87.10% | 1.40% | 2.51% | 8.99% | NA |
| Aus | 269 | 2.20% | 34.20% | 21.19% | 42.38% | NA |
| Indica I | 595 | 20.00% | 3.20% | 6.39% | 70.42% | NA |
| Indica II | 465 | 10.50% | 3.40% | 1.94% | 84.09% | NA |
| Indica III | 913 | 3.40% | 4.20% | 12.71% | 79.74% | NA |
| Indica Intermediate | 786 | 15.30% | 5.60% | 7.76% | 71.37% | NA |
| Temperate Japonica | 767 | 88.30% | 0.30% | 1.43% | 10.04% | NA |
| Tropical Japonica | 504 | 85.50% | 3.60% | 4.17% | 6.75% | NA |
| Japonica Intermediate | 241 | 86.70% | 0.40% | 2.49% | 10.37% | NA |
| VI/Aromatic | 96 | 13.50% | 1.00% | 77.08% | 8.33% | NA |
| Intermediate | 90 | 47.80% | 6.70% | 8.89% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618618072 | G -> A | LOC_Os06g32020.1 | upstream_gene_variant ; 1269.0bp to feature; MODIFIER | silent_mutation | Average:14.975; most accessible tissue: Callus, score: 27.977 | N | N | N | N |
| vg0618618072 | G -> A | LOC_Os06g32030.1 | downstream_gene_variant ; 4162.0bp to feature; MODIFIER | silent_mutation | Average:14.975; most accessible tissue: Callus, score: 27.977 | N | N | N | N |
| vg0618618072 | G -> A | LOC_Os06g32020-LOC_Os06g32030 | intergenic_region ; MODIFIER | silent_mutation | Average:14.975; most accessible tissue: Callus, score: 27.977 | N | N | N | N |
| vg0618618072 | G -> DEL | N | N | silent_mutation | Average:14.975; most accessible tissue: Callus, score: 27.977 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618618072 | 1.62E-09 | 4.02E-76 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 2.28E-09 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 4.64E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 2.37E-07 | 3.63E-08 | mr1071 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 2.74E-07 | 1.01E-07 | mr1080 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.39E-06 | 1.14E-07 | mr1100 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 9.80E-09 | 3.45E-10 | mr1140 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 7.63E-06 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.75E-08 | 8.68E-10 | mr1203 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 4.80E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.57E-09 | 5.00E-11 | mr1395 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 3.66E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 2.95E-08 | 1.23E-09 | mr1618 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.77E-06 | 1.61E-07 | mr1619 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 5.35E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 8.43E-07 | mr1993 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 4.21E-11 | 1.21E-101 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 2.47E-12 | mr1033_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.24E-08 | 4.29E-11 | mr1071_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 2.21E-09 | 2.27E-10 | mr1080_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 6.32E-11 | 1.03E-12 | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.82E-09 | 1.54E-11 | mr1203_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.03E-06 | 3.29E-09 | mr1402_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 9.73E-06 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 6.67E-08 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 1.81E-08 | 3.34E-09 | mr1619_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | 2.55E-06 | 5.18E-09 | mr1795_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618618072 | NA | 2.22E-06 | mr1878_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |