Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618527729:

Variant ID: vg0618527729 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18527729
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGGGAAAGGGAGTGCAGCCACCGCTAGCTTCCGCCCCTTTGGCCAGATTAGGAAGAGAGTGGAGGGGCTGTGGTGGAAAGGGAAGTGGAAAAGGTGAGG[T/G]
AGAGAGCTGAGACGGGTGAGGGGCTGAGAGGTCGAGCAGTTAGGGTGTGGGAGGGGCAAGGTGCGCTCGTTGGTTGTGATCCAATTTTTTTAAGCCGCTC

Reverse complement sequence

GAGCGGCTTAAAAAAATTGGATCACAACCAACGAGCGCACCTTGCCCCTCCCACACCCTAACTGCTCGACCTCTCAGCCCCTCACCCGTCTCAGCTCTCT[A/C]
CCTCACCTTTTCCACTTCCCTTTCCACCACAGCCCCTCCACTCTCTTCCTAATCTGGCCAAAGGGGCGGAAGCTAGCGGTGGCTGCACTCCCTTTCCCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	32.00%	5.21%	1.23%	NA
All Indica	2759	88.00%	9.20%	2.72%	0.04%	NA
All Japonica	1512	11.30%	80.00%	4.89%	3.77%	NA
Aus	269	95.90%	3.70%	0.37%	0.00%	NA
Indica I	595	79.20%	17.60%	3.19%	0.00%	NA
Indica II	465	88.80%	10.10%	1.08%	0.00%	NA
Indica III	913	96.60%	1.90%	1.53%	0.00%	NA
Indica Intermediate	786	84.40%	10.80%	4.71%	0.13%	NA
Temperate Japonica	767	12.80%	75.90%	5.22%	6.13%	NA
Tropical Japonica	504	12.10%	84.50%	2.98%	0.40%	NA
Japonica Intermediate	241	5.00%	83.80%	7.88%	3.32%	NA
VI/Aromatic	96	8.30%	3.10%	88.54%	0.00%	NA
Intermediate	90	48.90%	38.90%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618527729	T -> G	LOC_Os06g31890.1	upstream_gene_variant ; 1959.0bp to feature; MODIFIER	silent_mutation	Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0618527729	T -> G	LOC_Os06g31900.1	downstream_gene_variant ; 3918.0bp to feature; MODIFIER	silent_mutation	Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0618527729	T -> G	LOC_Os06g31890-LOC_Os06g31900	intergenic_region ; MODIFIER	silent_mutation	Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0618527729	T -> DEL	N	N	silent_mutation	Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618527729	NA	6.77E-10	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	8.10E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	2.95E-21	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	8.44E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	9.17E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	1.73E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	2.55E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	6.38E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	8.19E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	4.26E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	1.90E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	6.21E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	4.01E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	2.22E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	4.11E-06	4.82E-11	mr1681_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	5.18E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	9.17E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729	NA	1.10E-14	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251