\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618527729:

Variant ID: vg0618527729 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18527729
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGGAAAGGGAGTGCAGCCACCGCTAGCTTCCGCCCCTTTGGCCAGATTAGGAAGAGAGTGGAGGGGCTGTGGTGGAAAGGGAAGTGGAAAAGGTGAGG[T/G]
AGAGAGCTGAGACGGGTGAGGGGCTGAGAGGTCGAGCAGTTAGGGTGTGGGAGGGGCAAGGTGCGCTCGTTGGTTGTGATCCAATTTTTTTAAGCCGCTC

Reverse complement sequence

GAGCGGCTTAAAAAAATTGGATCACAACCAACGAGCGCACCTTGCCCCTCCCACACCCTAACTGCTCGACCTCTCAGCCCCTCACCCGTCTCAGCTCTCT[A/C]
CCTCACCTTTTCCACTTCCCTTTCCACCACAGCCCCTCCACTCTCTTCCTAATCTGGCCAAAGGGGCGGAAGCTAGCGGTGGCTGCACTCCCTTTCCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 32.00% 5.21% 1.23% NA
All Indica  2759 88.00% 9.20% 2.72% 0.04% NA
All Japonica  1512 11.30% 80.00% 4.89% 3.77% NA
Aus  269 95.90% 3.70% 0.37% 0.00% NA
Indica I  595 79.20% 17.60% 3.19% 0.00% NA
Indica II  465 88.80% 10.10% 1.08% 0.00% NA
Indica III  913 96.60% 1.90% 1.53% 0.00% NA
Indica Intermediate  786 84.40% 10.80% 4.71% 0.13% NA
Temperate Japonica  767 12.80% 75.90% 5.22% 6.13% NA
Tropical Japonica  504 12.10% 84.50% 2.98% 0.40% NA
Japonica Intermediate  241 5.00% 83.80% 7.88% 3.32% NA
VI/Aromatic  96 8.30% 3.10% 88.54% 0.00% NA
Intermediate  90 48.90% 38.90% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618527729 T -> G LOC_Os06g31890.1 upstream_gene_variant ; 1959.0bp to feature; MODIFIER silent_mutation Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0618527729 T -> G LOC_Os06g31900.1 downstream_gene_variant ; 3918.0bp to feature; MODIFIER silent_mutation Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0618527729 T -> G LOC_Os06g31890-LOC_Os06g31900 intergenic_region ; MODIFIER silent_mutation Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0618527729 T -> DEL N N silent_mutation Average:52.711; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618527729 NA 6.77E-10 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 8.10E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 2.95E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 8.44E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 9.17E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 1.73E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 2.55E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 6.38E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 8.19E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 4.26E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 1.90E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 6.21E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 4.01E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 2.22E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 4.11E-06 4.82E-11 mr1681_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 5.18E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 9.17E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618527729 NA 1.10E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251