\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618517599:

Variant ID: vg0618517599 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18517599
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTATTTTACCAATTTGTTTTTAGGGTTTATTCCTACTTAACTATTCTTTACTCATGATTAATGAACTTCGAAATCAAATCAAAATAAAATAGGCAAA[C/T]
AAGATCGGCATGATGCAATTAATTTAAAAAGTTTTTGAAAATCCGTATTTTTAGAGTTTTGATTTTTGCCGGTCGAATTTTCAGGGTGTTACACCGGGAG

Reverse complement sequence

CTCCCGGTGTAACACCCTGAAAATTCGACCGGCAAAAATCAAAACTCTAAAAATACGGATTTTCAAAAACTTTTTAAATTAATTGCATCATGCCGATCTT[G/A]
TTTGCCTATTTTATTTTGATTTGATTTCGAAGTTCATTAATCATGAGTAAAGAATAGTTAAGTAGGAATAAACCCTAAAAACAAATTGGTAAAATAAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.70% 0.30% 0.19% NA
All Indica  2759 91.60% 8.20% 0.22% 0.00% NA
All Japonica  1512 17.70% 81.30% 0.40% 0.60% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 84.00% 15.10% 0.84% 0.00% NA
Indica II  465 90.30% 9.50% 0.22% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 89.90% 10.10% 0.00% 0.00% NA
Temperate Japonica  767 20.20% 78.70% 0.39% 0.65% NA
Tropical Japonica  504 15.90% 83.90% 0.20% 0.00% NA
Japonica Intermediate  241 13.30% 84.20% 0.83% 1.66% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618517599 C -> T LOC_Os06g31880.1 upstream_gene_variant ; 3767.0bp to feature; MODIFIER silent_mutation Average:24.53; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0618517599 C -> T LOC_Os06g31860.1 downstream_gene_variant ; 3927.0bp to feature; MODIFIER silent_mutation Average:24.53; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0618517599 C -> T LOC_Os06g31870.1 intron_variant ; MODIFIER silent_mutation Average:24.53; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0618517599 C -> DEL N N silent_mutation Average:24.53; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618517599 5.63E-07 4.29E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 2.46E-06 5.13E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 7.02E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 1.43E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 6.36E-07 7.89E-13 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 1.57E-06 7.31E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 4.55E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 8.77E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 1.14E-18 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 3.31E-06 NA mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 5.20E-06 7.07E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 5.23E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 1.70E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 3.13E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 1.99E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 2.26E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 7.07E-06 7.76E-13 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 8.88E-06 mr1667_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 2.88E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 7.61E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618517599 NA 3.77E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251